sena masthead
SENA Home Staff & Editors For Readers For Authors

Occurrence of Juvenile Paralichthys lethostigma (Southern Flounder) in Tributaries of Chesapeake Bay
Sean C. Lusk, Brian E. Watkins, Ashleigh Rhea, Casey B. Dillman, and Eric J. Hilton

Southeastern Naturalist, Volume 13, Issue 3 (2014): 515–522

Full-text pdf (Accessible only to subscribers.To subscribe click here.)

 



Access Journal Content

Open access browsing of table of contents and abstract pages. Full text pdfs available for download for subscribers.

Issue-in-Progress: Vol. 25( 3) ... early view

Current Issue: Vol. 25 (2)
cover SENA 25(2)

Check out SENA's latest Monograph and current Special Issue in progress:

Monograph 13
SENA Monograph 13

Special Issue 13 in progress
SENA 24(special issue 13)

All Regular Issues

Monographs

Special Issues

 

submit

 

subscribe

 

JSTOR logoClarivate logoWeb of science logoBioOne logo EbscoHOST logoProQuest logo


Southeastern Naturalist 515 S.C. Lusk, B.E. Watkins, A. Rhea, C.B. Dillman, and E.J. Hilton 22001144 SOUTHEASTERN NATURALIST 1V3o(3l.) :1531,5 N–5o2. 23 Occurrence of Juvenile Paralichthys lethostigma (Southern Flounder) in Tributaries of Chesapeake Bay Sean C. Lusk1,*, Brian E. Watkins2, Ashleigh Rhea2, Casey B. Dillman2, and Eric J. Hilton2 Abstract - Paralichthys lethostigma (Southern Flounder) inhabits the continental shelf and estuarine waters of the Gulf of Mexico and the east coast of the North Atlantic, from peninsular Florida to Albemarle Sound in North Carolina. Between 30 May and 20 August 2012, we collected 15 juvenile (71–192 mm) Southern Flounder in fyke nets in the Mattaponi River, a tributary of the York River, in southeastern Virginia. This is the first known documentation of juvenile Southern Flounder in any tributary of Chesapeake Bay. We confirmed our identification of the specimens as Southern Flounder morphologically and genetically by counting gill rakers and sequencing cytochrome oxidase subunit I, respectively. Introduction Paralichthys lethostigma Jordan and Gilbert (Southern Flounder) is a member of the family Paralichthyidae, the left-eyed flounders. It is characterized by extreme lateral compression, with both eyes located on the left side of the body, and dark brown mottled pigmentation on the left side of the body; it can be distinguished from other members of the family through a combination of meristic data (e.g., fin ray and gill-raker counts). This carnivorous species inhabits the continental shelf and estuarine waters of the western North Atlantic (McEachran and Fechhelm 2005, Murdy and Musick 2013, Murdy et al. 1997). Adults migrate to the continental shelf to spawn in the fall (Gi1bert 1986), and once eggs have hatched, larvae are carried to estuaries and coastal rivers by inshore currents (Guindon and Miller 1995). Juvenile Southern Flounder live in estuaries and rivers for approximately 2 years (Daniels 2000), feeding primarily on plankton, macroinvertebrates, and small fishes, after which they reach spawning age (Van Maaren and Daniels 2008). Southern flounder are sought by both commercial and recreational fishermen along the Gulf and eastern coasts of the US (Stokes 1977) and are a managed species throughout their range. Southern Flounder are distributed along the coast of the Gulf of Mexico, from the southern tip of Texas to Caloosahatchee River in Florida, and on the Atlantic coast from the Loxahatchee River in Florida to Albemarle Sound in North Carolina (Fischer and Thompson 2004). This species inhabits shallow bays, estuaries, and rivers that are characterized by mud and silt substrates. Adult Southern Flounder are known to stray into the southern regions of Chesapeake Bay during late summer and 1Department of Fisheries and Wildlife Conservation, Virginia Polytechnic Institute and State University, Blacksburg, VA 24061. 2Department of Fisheries Science, Virginia Institute of Marine Science, Gloucester Point, VA 23062. *Corresponding author - slusk@vt.edu. Manuscript Editor: Jennifer Rehage Southeastern Naturalist S.C. Lusk, B.E. Watkins, A. Rhea, C.B. Dillman, and E.J. Hilton 2014 Vol. 13, No. 3 516 early fall (Murdy and Musick 2013). Several individuals have been encountered between August and November (2007–2009) during electroshocking surveys in the Pamunkey, James, and Chickahominy rivers (Virginia) conducted by the Virginia Department of Game and Inland Fisheries (VDGIF) (B. Greenlee, VDGIF, Charles City, VA, pers. comm.), as well as the Virginia Institute of Marine Science (VIMS) Juvenile Fish and Blue Crab Trawl Survey (VIMS 4750; collected at the mouth of the James River in August 2009). Between May and August 2012, researchers with the American Shad Monitoring Program at VIMS collected several juvenile Southern Flounder in fyke nets in the tidal freshwater reaches of the Mattaponi River, a tributary of the York River in Virginia. The purpose of this paper is to document and discuss the occurrence of this southern species in tributaries of Chesapeake Bay. Field Station Description The Mattaponi River joins the Pamunkey River at West Point, VA, to form the York River, and collectively the 3 rivers form the York River System (YRS). We sampled in the Mattaponi River between Melrose Landing and Walkerton, VA, in the river’s numerous tidal freshwater marshes. Sediments in tidal freshwater marshes in this area are dominated by silt, with vegetation comprising mainly Peltandra virginica (L.) Schott (Green Arrow-arum), Leersia oryzoides (L.) Sw. (Rice Cutgrass), and Bidens spp. (beggarticks) (Priest et al 1987). Our sampling stations were as follows: station 1 (Walkerton Landing) river mile (RM) 53 (37°43.4' N, 77°01.0'W); station 2 (upriver of Garnetts Creek), RM 49 (37°41.4' N, 76°57.5'W); station 3 (Sandy Point), RM 46 (37°40.9'N, 76°55.0'W); station 4 (Wakema), RM 43 (37°39.3' N, 76°53.5'W); and station 5 (Melrose Landing), RM 41 (37°38.6' N, 77°52'W) (Fig. 1). Station 1 is located on the southern bank of an island closest to the northern bank of the river and experiences a major growth of Hydrilla verticillata (L.f.) Royle (Hydrilla) and other submerged aquatic vegetation (SAV) in mid- to late summer. Station 2 is located on the southern bank of the river near the mouth of a large creek, but there is little or no SAV growth. Station 3 is located on the northern bank of the river on a small flat just above a steep drop-off. Station 4 is located close to the mouth of a creek, and station 5 is located on the southern bank of the river on the northern bank of a small island; this fifth station experiences little to no SAV. Typical of freshwater tidal marshes in the region, all stations have a silt-dominated substrate. Methods Sampling We sampled for 15 weeks during 15 May–21 August 2012 by setting fyke nets at the 5 stations. Electroshocking and trawling were used sporadically to supplement the fyke nets at the 5 stations and to sample different portions of the river that contained suitable habitat for Southern Flounder (i.e., silt and mud substrates associated with areas of aquatic vegetation). We constructed fyke nets out of 6.35-mm (0.25-inch)-mesh netting. Each net consisted of a 15.2-m leader, two 7.6-m wings, Southeastern Naturalist 517 S.C. Lusk, B.E. Watkins, A. Rhea, C.B. Dillman, and E.J. Hilton 2014 Vol. 13, No. 3 4 hoops, 2 throats, and 1 cab. Each fyke net was set perpendicular to the shore with the leader running on shore and wings running at a 45° angle from the leader. We set all nets at low tide and fished during the first low tide of the following day (tides and weather permitting) to complete a 24-hour set; nets were removed after fishing (n = 5 fyke nets deployed). We identified all species collected in the fyke nets and transported Southern Flounder to the laboratory for further processing. We recorded surface water temperature (°C) and salinity (ppm) at each of the 5 stations on the day the fyke nets were deployed and on the day the fyke nets were fished. We conducted electroshocking on 12 July 2012 in the Mattaponi River and 20 June 2012 on Back Bay in southeastern Virginia. We employed a 5.59-m (19’) aluminum Clark electrofishing boat (Clark Boat Company, Bellevue, IA) equipped with a double-electrode array, each with 6 droppers. Our pulse box was a Smith Root 9.0 GPP (Generator Powered Pulsator, Smith Root International, Vancouver, WA) that was set to maximum output at 680v, with 120 pulses per second at 20 amps. The sampling crew consisted of a driver, a spotter, and 2 netters. Our electroshocking effort varied with location and depended on the size of the area we deemed as suitable Southern Flounder habitat. We used a standard otter-trawl with a 4.88 m (16’) headrope, 3.81 cm (1.5”) stretch-bar body, 1.9 cm (0.75”) stretch-bar cod-end, 0.63 cm (0.25”) cod-end liner, and a 22.86 m (75’) rope bridle; tow speeds were 1–3 knots. We conducted nine 5-minute trawls and Figure 1. Map of fyke-net sampling-stations along the Mattaponi River in southeastern Virginia. Southeastern Naturalist S.C. Lusk, B.E. Watkins, A. Rhea, C.B. Dillman, and E.J. Hilton 2014 Vol. 13, No. 3 518 one 10-minute trawl on 11 June 2012, and ten 5-minute trawls on 18 June 2012 (total = 20 trawls). Specimen processing We counted the total number of gill rakers on the first arch of all individuals and identified fish with 10–14 gill rakers as Southern Flounder; the sympatric species Paralichthys dentatus L. (Summer Flounder) has 16–24 gill rakers on the first arch (Murdy et al. 1997), a diference that allowed us to make positive identifications. We recorded total length (TL; mm) and weight (g) of all Southern Flounder specimens and removed sagittal otoliths for age estimation; a tissue sample was removed and stored in 95% ethanol for genetic analysis. We preserved all specimens in formalin and stored them in the VIMS ichthyology collection. Multiple people collected, prepared, and read otoliths. However, we found that daily age estimates derived from these reads were not reliable due to lack of clarity; therefore, age data are not reported here. Genetic analysis We analyzed tissue from 6 of the individuals collected in the Mattaponi River for a genetic identification; we included an adult specimen collected in Back Bay, VA (VIMS 13589) in our analysis. DNA was extracted using a QIAGEN DNeasy kit (QIAGEN, Inc., Valencia, CA) following the manufacturer’s protocol. We amplified cytochrome oxidase subunit I (COI) using PCR on a BIORAD S1000 thermal cycler (Bio Rad, Hercules, CA). PCR reactions (25 μl) were completed using 13.3 μl water, 5 μl of 5x PCR Buffer, 3 mM MgCl, 0.5 μl of 200-μM dNTPs, 1 μl each of the COI primers HCOI 5' TAAACTTCAGGGTGACCAAAAAATCA 3', and LCOI 5' GGTCAACAAATCATAAAGATATTG 3' (Folmer et al. 1994) for a concentration of 0.4 μM , 1 unit Taq polymerase (Promega Corporation, Madison, WI), and 1 μl DNA. We used the following temperature cycle: initial denaturing at 94 °C for 4 minutes followed by 45 cycles of denaturation at 94 °C for 1 minute, annealing at 45 °C for 1 minute, and extending at 72 °C for 1 minute; final extension was at 72 °C for 10 minutes. We screened PCR products for successful amplification on a 1% agarose gel, excised the COI amplicon, and purified it using the QIAGEN gelextraction protocol. Sequencing reactions used ABI’s BigDye (Life Technologies, Carlsbad, CA) chemistry and were completed by denaturing at 96 °C for 1 minute followed by 25 cycles of 96 °C for 1 minute, 50 °C for 1 second, and 60 °C for 5 seconds. DNA was precipitated using ethanol/sodium acetate following the manufacturer’s protocol. We ran out sequences on an ABI 3130 genetic analyzer (Life Technologies, Carlsbad, CA), and used Sequencher V.4.10.1 (Gene Codes Corporation, Ann Arbor, MI) to visualize chromatograms, create contigs, edit the forward and reverse sequences. We compared sequences to most closely related sequences using a BLAST search of GenBank (http://www.ncbi.nim.nih.gov/genbank). Results During 16 June–28 August 2012, we collected 21,923 individual fishes (51 species) in fyke nets. The average water temperature for the period was 27.5 °C Southeastern Naturalist 519 S.C. Lusk, B.E. Watkins, A. Rhea, C.B. Dillman, and E.J. Hilton 2014 Vol. 13, No. 3 (Table 1). We collected a total of 15 juvenile Southern Flounder from fyke-net sampling; these individuals weighed 2.56–84.0 g and were 71–192 mm TL (Fig. 2). We collected Southern Flounder at all 5 stations, with most individuals captured at station 1 (n = 6). A single Southern Flounder (84.0 g, 190 mm TL) was collected during electroshocking. Our gill-raker counts confirmed that all specimens collected were Southern Flounder (Table 2). We were able to obtain usable sequencing results from 3 of the 6 tissue samples collected from the Mattaponi River for genetic confirmation. BLAST-search results for those 3 samples matched Southern Flounder sequences generated by Weigt (2012). Table 1. Catch data from fyke-net sampling in the Mattaponi River. Total number collected Water Date Fishes Species Families Southern Flounder temp. (°C) 5/16/2012 1873 25 14 0 22.15 5/22/2012 1781 26 18 0 21.87 5/30/2012 1671 32 17 3 26.37 6/5/2012 1431 28 13 1 24.20 6/12/2012 1369 31 16 5 25.50 6/19/2012 3291 27 15 2 24.24 6/26/2012 1327 32 16 1 27.82 7/3/2012 1127 26 17 2 29.66 7/10/2012 563 24 15 0 30.91 7/18/2012 1943 36 15 0 30.54 7/24/2012 846 30 17 1 29.77 7/31/2012 1800 30 13 0 30.43 8/7/2012 1731 40 16 0 30.67 8/15/2012 1005 28 16 0 29.11 8/21/2012 556 32 16 0 26.52 Table 2. Data from specimens of Southern Flounder collected in the Mattaponi River. Gill-raker Specimen # Date collected Station Gear type TL (mm) Weight (g) count VIMS 13578a 5/30/2012 4 Fyke net 75 3.54 12 VIMS 13578b 5/30/2012 4 Fyke net 71 2.56 12 VIMS 13579 5/30/2012 1 Fyke net 92 5.84 12 VIMS 13588 6/5/2012 3 Fyke net 81 3.28 10 VIMS 13580a 6/13/2012 1 Fyke net 112 13.92 12 VIMS 13584 6/13/2012 3 Fyke net 118 15.34 11 VIMS 13580b 6/13/2012 1 Fyke net 117 15.84 13 VIMS 13580c 6/13/2012 1 Fyke net 127 19.92 13 VIMS 13580d 6/13/2012 1 Fyke net 129 20.71 13 VIMS 13586 6/19/2012 5 Fyke net 108 11.90 10 VIMS 13583 6/26/2012 2 Fyke net 93 6.94 13 VIMS 13581 7/3/2012 1 Fyke net 157 36.14 12 VIMS 13587 7/3/2012 5 Fyke net 149 30.86 12 VIMS 13582 7/12/2012 Near 1 Electroshocking 190 84.00 12 VIMS 13585 7/24/2012 3 Fyke net 192 71.30 11 Southeastern Naturalist S.C. Lusk, B.E. Watkins, A. Rhea, C.B. Dillman, and E.J. Hilton 2014 Vol. 13, No. 3 520 Discussion Morphological and genetic analyses confirmed that Southern Flounder were present in the Mattaponi River in the summer of 2012. Wenner et al. (1990) found that male and female Southern Flounder reach maturity at 230 mm and 320 mm, respectively. All individuals collected in the present study were significantly smaller than 230 mm; therefore, we identified them as juveniles. The Mattaponi River is ~200 miles north of the northernmost reported spawning population of Southern Flounder (Blandon et al. 2001, Enge and Mulholland 1985, Gilbert 1986). Although adult individuals are known to enter the lower Chesapeake Bay in late summer and fall (Murdy et al. 1997; B. Greenlee, pers. comm.), the occurrence of juveniles has not been recorded. It is possible that the presence of juvenile Southern Flounder in the Mattaponi River is a rare event; there may have been a slight alteration of offshore ocean currents that carried larvae up the Atlantic coast and deposited them in the lower Chesapeake Bay. These larvae ingressed into the Mattaponi River in early spring, likely as a result of the North Carolina population of Southern Figure 2. Juvenile Paralichthys lethostigma (Southern Flounder) from the Mattaponi River. A) VIMS 13579, caught 30 May 2012 (92 mm TL; fixed in formalin prior to photo). B) VIMS 13585, caught 24 July 2012 (192 mm TL). Scale bars equal 20 mm. Southeastern Naturalist 521 S.C. Lusk, B.E. Watkins, A. Rhea, C.B. Dillman, and E.J. Hilton 2014 Vol. 13, No. 3 Flounder spawning farther north than they have historically, perhaps due to warming coastal temperatures. Cheung et al. (2013) recently suggested that there is a strong correlation between rising ocean temperature and an increase in the presence of warm-water fishes in higher latitudes. An additional study looking at the correlation between Chesapeake Bay winter water temperatures and the survival rate of juvenile Southern Flounder in the bay would be invaluable in determining how this species responds to changing ecological environments. Gibson (1994) found that temperature, and to a lesser extent salinity, is the most important abiotic factor for optimal survival of juvenile flatfishes. Daniels et al. (1996) found that pre-metamorphosis, Southern Flounder suffered 100% mortality when exposed to salinities of 0 parts per thousand (ppt). Daily salinity recorded at all stations sampled was less than 1 ppt. Therefore, the individuals collected in our sampling likely metamorphosed prior to entering the freshwater reaches of the Mattaponi River, probably in either the main stem Chesapeake Bay or in the lower York River system. This pattern of migration from saline to fresh waters, including substantial use of freshwater habitats, was described by Lowe et al. (2011), who reported that juvenile Southern Flounder select freshwater habitats (typically estuaries) based on biological, chemical, and physical characteristics. Additionally, they suggest that juvenile Southern Flounder use these freshwater habitats as a nursery area before they mature and migrate back to the continental shelf to spawn. Acknowledgments We thank Ryan Norris for assistance in the field, and Katie May Laumann for assistance with the sequence data. We are grateful to Tom Wadsworth (North Carolina Department of Marine Fisheries, Moorehead City, NC) and VDGIF staff Chad Boyce, Bob Greenlee and Scott Hermann for providing data and for assistance in the field, and to Rob Latour (VIMS) for discussion. This study was conducted as part of a research experience for undergraduates at VIMS (NSF 0552612), and we thank the principal investigators and others involved in this program, including Linda Schaffner, Rochelle Seitz, Jennifer Dreyer, and Gina Ralph. Funding for the fyke-net survey was provided through the Virginia Marine Resources Commission and US Fish and Wildlife Service (F-116-R-15). This is contribution 3296 of the Virginia Institute of Marine Science, College of William & Mary. Literature Cited Blandon, I.R., T.L. King, W.J. Karel, and J.P. Monaghan, Jr. 2001. Preliminary genetic population structure of Southern Flounder, Paralichthys lethostigma, along the Atlantic Coast and Gulf of Mexico. US National Marine Fisheries Service Fishery Bulletin 99:671–678. Cheung, W.W.L., R. Watson, and D. Pauly. 2013. Signature of ocean warming in global fisheries catch. Nature 497:365–368. Daniels, H.V. 2000. Species profile: Southern Flounder, Southern Regional Aquaculture Center. Available online at http://www.ca.uky.edu/wkrec/southernflounder.pdf. Accessed 13 June 2012. Southeastern Naturalist S.C. Lusk, B.E. Watkins, A. Rhea, C.B. Dillman, and E.J. Hilton 2014 Vol. 13, No. 3 522 Daniels, H.V, D.L. Berlinsky, R.G. Hodson, and C.V. Sullivan. 1996. Effects of stocking density, salinity, and light intensity on growth and survival of Southern Flounder, Paralichthys lethostigma, larvae. Journal World Aquaculture Society 27:153–159. Enge, K.M., and R. Mulholland. 1985. Habitat-suitability index models: Southern and Gulf Flounders. US Fish and Wildlife Service Biological Report 82. Department of the Interior, Washington, DC. 25 pp. Fischer, A.J., and B.A. Thompson. 2004. The age and growth of Southern Flounder, Paralichthys lethostigma, from Louisiana estuarine and offshore waters. Bulletin of Marine Science 75:63–77. Gibson, R.N. 1994. Impact of habitat quality and quantity on the recruitment of juvenile flatfishes. Netherlands Journal of Sea Research 32:191–206. Gi1bert, C.R. 1986. Species profiles: Life histories and environmental requirements of coastal fishes and invertebrates (South Florida): Southern, Gulf, and Summer Flounders. US Fish and Wildlife Service Biological Report 82. Department of the Interior, Washington, DC. 14 pp. Guindon, K.Y., and J.M. Miller. 1995. Growth potential of juvenile Southern Flounder, Paralichthys lethostigma, in low-salinity nursery areas of Pamlico Sound, North Carolina USA. Netherlands Journal of Sea Research 34:89–100. Lowe, M.R., D.R. DeVries, R.A. Wright, S.A. Ludsin, and B.J. Fryer. 2011. Otolith microchemistry reveals substantial use of freshwater by Southern Flounder in the northern Gulf of Mexico. Estuaries and Coasts 34:630–639. McEachran, J.D., and J. D. Fechhelm. 2005. Fishes of the Gulf of Mexico, Volume 2. University of Texas Press, Austin, TX. 1004 pp. Murdy E.O., and J.A. Musick. 2013. Field Guide to Fishes of Chesapeake Bay. Johns Hopkins University Press, Baltimore, MD. 346 pp. Murdy, E.O., R.S. Birdsong, and J A. Musick. 1997. Fishes of Chesapeake Bay. Smithsonian Institution Press, Washington DC. 324 pp. Priest, W.I., G.M. Silberhorn, and A.W. Zacherle. 1987. King and Queen County tidal marsh inventory. Applied Marine Science and Ocean Engineering Special Report No. 291. Virginia Institute of Marine Science, Gloucester Point, VA. 43 pp. Stokes, G.M. 1977. Life-history studies of Southern Flounder (Paralichthys lethostigma) and Gulf Flounder (P. albigutta) in the Aransas Bay areas of Texas. Texas Parks and Wildlife Departmental Technical Series 25:1–37. Van Maaren, C.C., and H.V. Daniels. 2008. A practical guide to the morphological development of Southern Flounder, Paralichthys lethostigma, from hatch through metamorphosis. Journal of Applied Aquaculture 10:1–9. Wenner, C.A., W.A. Roumillat, J.R. Moran, Jr., M.B. Maddox, L.B. Daniel III, and J.W. Smith. 1990. Investigations on the life history and population dynamics of marine recreational fishes in South Carolina: Part 1. Marine Resources Research Institute. SC DNR, F–37 35. Charleston, SC. Weigt, L.A., C. Baldwin, A.C. Driskell, D.G. Smith, A. Ormos, and E.A Reyier. 2012. Using DNA barcoding to assess Caribbean reef-fish biodiversity: Expanding taxonomic and geographic coverage. PLoS One 7:e41059.