Northeastern Naturalist Vol. 26, No. 3 A.P. Young, R.C. Evans, R. Newell, and A.K. Walker 2019 465 2019 NORTHEASTERN NATURALIST 26(3):465–483 Development of a DNA Barcoding Protocol for Fungal Specimens from the E.C. Smith Herbarium (ACAD) Alexander P. Young1, Rodger C. Evans1, Ruth Newell1, and Allison K. Walker1,* Abstract - Many field-collected fungal specimens are maintained in herbaria worldwide. These specimens contain an untapped wealth of taxonomic and ecological fungal biodiversity information. However, DNA can be difficult to obtain from preserved specimens. We present a DNA barcoding protocol specifically for preserved fungal specimens (ascomycetes and basidiomycetes). The E.C. Smith Herbarium at Acadia University houses 20,000 fungal specimens representative of northeastern North America. We achieved a DNA barcoding success rate of 18% from pre-1980 specimens (n = 39) using a kit-based DNA extraction protocol and sequencing of the full internal transcribed spacer (ITS) region of ribosomal DNA. This result surpassed success rates of previous protocols. We also explored the use of mini-barcodes from the ITS1 region only. Mini-barcodes (n = 13) demonstrated a 92% success rate in post-1980 specimens compared to full barcodes (46% success rate, n = 13) while retaining all the identification power of full barcodes in the examined specimens. Our approach will enable herbarium collections to be used more efficiently to populate DNA sequence databases such as GenBank. This approach will expand the number of reference DNA barcode sequences from vouchered fungal specimens within publicly available databases. Introduction Herbaria are systematically arranged collections of preserved plant and fungal specimens that provide valuable biodiversity information to support studies on taxonomy, geographic distribution, and nomenclature, and for education. Herbaria have existed for hundreds of years but have recently gained popularity and recognition as a resource for molecular research. Field-collected fungal specimens housed in herbaria can be particularly useful as reference material for phylogenetic investigations (Bruns et al. 1990, White et al. 1990). Herbarium specimens often contain useful geographical and morphological information which aids in species identifications. However, accuracy is not always ensured when relying solely on morphological characterization. Due to the phenotypic plasticity of many fungi during complex life cycles, advanced expertise is required to identify certain groups of fungi (Bemmann 1981). The development of molecular identification of fungi has made identification of organisms to the species level much less ambiguous and allowed for the recognition of asexual and sexual forms of the same fungus as the same species (Begerow et al. 1997). Most fungal herbarium specimens, however, lack reliable species-level molecular identification (Nilsson et al. 2006, Xu 2016). Herbarium-based DNA sequencing projects, 1Department of Biology, Acadia University, 33 Westwood Avenue, Wolfville, NS B4P 2R6, Canada. *Corresponding author - allison.walker@acadiau.ca. Manuscript Editor: Adrienne Kovach Northeastern Naturalist 466 A.P. Young, R.C. Evans, R. Newell, and A.K. Walker 2019 Vol. 26, No. 3 therefore, have incredible potential to close the steep taxonomic gap between the number of identified fungi and the total estimated number of fungal species on Earth (Begerow et al. 2010, Brock et al. 2009, Schoch et al. 2012). The current method of molecular identification of fungi is DNA barcoding (Schoch et al. 2012). A DNA barcode refers to a specific region of DNA that can be used to identify an organism under the premise that the rate of interspecific evolution of that DNA region will exceed the rate of intraspecific evolution (Hebert et al. 2003). DNA barcoding of a fungal specimen requires the selective amplification of the internal transcribed spacer (ITS) regions of ribosomal DNA (comprised of ITS1, 5.8S ribosomal DNA, and ITS2 concatenated). The entire ITS sequence composes a full barcode and can be used to resolve specimen identity based on sequence similarity from reference databases such as GenBank and UNITE (Schoch et al. 2012). DNA barcoding can be an effective tool to assign identities to the increasing number of fungal species discovered. Current estimates of the total number of fungal species present on Earth are between 2.2 million and 3.8 million, only 120,000 of which have been identified (Hawksworth and Lücking 2017). Herbarium barcoding projects create opportunities to improve species-level identification of herbarium specimens, describe new species, and augment the collection of reference fungal barcode sequences in public databases such as GenBank (Benson et al. 2005, Yahr et al. 2016). These data aid in the future identification of novel species and improve our knowledge of phylogenetic relationships among known taxa. Herbaria provide easy access to a wealth of species that can be used to acquire molecular data; however, preserved fungal specimens are notoriously difficult to barcode. Current published herbarium barcoding methods provide <40% success rates, with very low success rates from specimens that are >30 y old, as genomic DNA of preserved specimens degrades over time (Dabney et al. 2013, Dentinger et al. 2010, Osmundson et al. 2013, Taylor and Swann 1994). One approach to barcode highly degraded DNA is through fungal mini-barcodes, which rely only on sequencing of the ITS1 DNA fragment as opposed to the entire ITS region (Osmundson et al. 2013). Mini-barcodes have been proposed as a suitable alternative to barcode museum specimens with degraded DNA and could be successful with fungal herbarium specimens (Hajibabaei and McKenna 2012). As preserved fungal specimens often contain low quantities of quality genomic DNA, the efficiency of the method used to extract the DNA can strongly influence barcoding success. Currently, the most common methods of extracting DNA from preserved fungi involve modified cetyltrimethyl ammonium bromide (CTAB) protocols (Cubero et al. 1999, Drábková 2014, Forin et al. 2018, Osmundson et al. 2013). CTAB DNA extractions, however, can be time-consuming and require large amounts of fungal tissue. A few prior studies have employed commercial kitbased DNA extractions; these methods show promise but are not always reliable in herbarium specimens (Kelly et al. 2011, Staats et al. 2013). Development of an effective kit-based DNA extraction protocol for herbarium specimens may allow investigators to obtain genetic data from herbarium specimens of fungi with a higher rate of success, more quickly, and at a lower cost. Northeastern Naturalist Vol. 26, No. 3 A.P. Young, R.C. Evans, R. Newell, and A.K. Walker 2019 467 We present an efficient, reliable, and consistent kit-based DNA extraction method to isolate DNA from preserved ascomycete and basidiomycete fungal herbarium specimens of various ages. We also provide a complementary PCR protocol for use in herbarium DNA sequencing projects and explore the use of ITS1 mini-barcodes as a potential alternative for exceptionally challenging specimens (Meusnier et al. 2008, Osmundson et al. 2013). Materials and Methods Sample selection We selected a variety of preserved fungal specimens based on availability from the E.C. Smith Herbarium (ACAD) at Acadia University, Wolfville, NS, Canada. Specimens used in this study (n = 95) included mushrooms, saltmarsh ascomycetes, and lichens collected in different decades (see Appendix A for list of specimens used; specimens for which useable barcodes were obtained show corresponding GenBank accession numbers). Of the samples we used in this research, 39 were collected in Nova Scotia by Gregory Boland in 1975 (Boland and Grund 1979). Boland surveyed the fungal biodiversity of the Minas Basin and collected 86 specimens, 20 of which were basidiomycetes (mushrooms); the remaining 66 were marine ascomycetes preserved as dried fruiting bodies on dried Spartina alterniflora Loisel. (Poaceae; Smooth Cordgrass). To sequence other specimens of various ages, we selected up to 5 samples from 2 additional decades: the 1980s and 1990s. We also sampled a final group of relatively modern specimens from 2011. The sample sizes for these additional time periods were small and were based on availability within the E.C. Smith Herbarium. Specimen age spanned from 5 y (collected in 2011) to 41 y (collected in 1975) at the time of DNA extraction. Sample preparation and DNA extraction protocol We sampled the fungal herbarium specimens from the E.C. Smith Herbarium and prepared them for DNA extraction as follows: after microscopic examination, we removed portions of tissue with sterile tweezers and scissors on a surface sprayed with 70% ethanol. For dried basidiomycetes (mushrooms), we sampled 5–25 mg of tissue from the outer border of the hymenium; the amount of tissue sampled depended on the size of the specimen. For the marine ascomycetes, we sampled at least 3 visible fruiting bodies (ascomata or pycnidia) from the dried plant material. For lichens, we sampled 5 mg of thallus tissue. We placed each specimen into to a sterile, 1.5-mL plastic microcentrifuge tube containing 1 mL sterile distilled water and inverted tubes several times to minimize the carryover of potential surface contaminants. We ground specimens into a fine powder under liquid nitrogen in an autoclaved ceramic mortar and pestle (CoorsTek, Golden, CO). DNA extraction followed immediately after specimen preparation. We tested 2 commercial DNA isolation kits among the 39 specimens collected in 1975 to determine success rates for full ITS barcodes from herbarium specimens: the G-Biosciences Omniprep® kit (GBO kit; MJS Biolynx, Brockville, ON) and the Ultraclean® Soil DNA Isolation Kit (MBO kit; Mo Bio Northeastern Naturalist 468 A.P. Young, R.C. Evans, R. Newell, and A.K. Walker 2019 Vol. 26, No. 3 Laboratories, Carlsbad, CA, now manufactured by Qiagen, Hilden, DE). We selected the GBO kit because it has been used successfully in herbarium-based fungal barcoding projects (Q. Eggertson, Agriculture and Agri-Food Canada, Ottawa, ON, Canada, pers. comm.). We chose the MBO kit because it can be used for the isolation of DNA from fungi in environmental samples. We tested all 39 specimens with the GBO kit and 30 of them with the MBO kit. We compared the performance of the 2 kits with respect to their ability to obtain full barcodes from 1975 herbarium specimens. For the MBO kit, we followed the standard protocol as outlined in the manufacturer’s instructions. For the GBO kit, we followed the fungal tissue protocol contained within the GBO kit booklet for the first 5 steps, which included sample collection and homogenization as well as lysis with proteinase-K treatment. Then, we followed the solid tissue protocol from step 5, which was the separation of DNA from protein via chloroform (protocol 786-136S). During the solid tissue protocol, we incubated samples for the maximum suggested times for each step (Appendix B). To maximize nucleic acid yield following extraction, we added 2 μL of mussel glycogen to each sample as a DNA carrier. We analysed concentration and purity of total DNA extracts with a nanodrop spectrophotometer (Montreal Biotech Inc., Montreal, QC, Canada). Full barcode amplification and species identification We subjected all samples from 1975 that produced a measurable yield from DNA extractions (for GBO kit, n = 18; for MBO kit, n = 23) to the full barcoding protocol. We performed polymerase chain reactions (PCR) to amplify full barcodes (~700 bp) from the entire ITS region. We used Illustra PuReTaq Ready-To-Go PCR Bead tubes (GE Healthcare, Little Chalfont, UK) for PCR as per Raja et al. (2017). To amplify barcode regions from the ascomycete samples, we employed the ITS1- F primer (Gardes and Bruns 1993) and a phylum-specific reverse primer ITS4-A (Larena et al. 1999). We used the ITS1-F and ITS4-B reverse primer to amplify basidiomycete specimens (Table 1; Gardes and Bruns 1993). PCR reactions consisted of 2.5 units of recombinant PuReTaq DNA polymerase, 200 μM of each dNTP, 160 nM each of forward and reverse primers, 4.0 mM MgCl2, 5 ng BSA, 50 mM KCl, 10 mM Tris-HCl, 100–250 ng of template DNA, and nuclease-free water to yield a total reaction volume of 25 μL. We obtained reagents from Thermo Fisher Scientific (Walton, MA). We conducted PCR in a Biometra® PCR TGradient thermocycler (Biometra GmbH, Göttingen, DE) with the following parameters: 95 ºC for 3 min; Table 1. PCR primer sequences for the fungal nuclear ribosomal internal transcribed spacer (ITS) region. Primer Sequence (5'-3') Reference ITS1-F CTTGGTCATTTAGAGGAAGTAA Gardes and Bruns 1993 ITS2 GCTGCGTTCTTCATCGATGC White et al. 1990 ITS4-A CGCCGTTACTGGGGCAATCCCTG Larena et al. 1999 ITS4-B CAGGAGACTTGTACACGGTCCAG Gardes and Bruns 1993 Northeastern Naturalist Vol. 26, No. 3 A.P. Young, R.C. Evans, R. Newell, and A.K. Walker 2019 469 35 cycles of 95 ºC for 60 sec, 52 ºC for 30 sec, 72 ºC for 60 sec, and 72 ºC for 10 min. We assessed PCR products by gel electrophoresis of 5 μL of PCR product on a 1% (w/v) TAE agarose gel with in-gel ethidium bromide. We ran gels for 30 min at 100 v, subsequently visualized DNA on a GelDoc UV transilluminator (Bio-Rad Laboratories, Hercules, CA), and used GeneRuler 100bp Plus Ladder as a molecular size marker (Thermo Fisher Scientific, Walton, MA). We shipped successfully amplified samples overnight to the Genome Québec Innovation Centre (McGill University, Montreal, QC, Canada) for Sanger sequencing. We then used the successful barcode sequences that were returned by the Genome Québec Innovation Centre to identify the herbarium specimens. We BLAST-searched the sequences against the GenBank database and we assigned identities based on a >97% match to 1 or multiple reference sequences. Mini-barcodes We acquired mini-barcodes (~300 bp) from the selective amplification of the ITS1 portion of the ITS region using PCR primers ITS1-F and ITS2 (Gardes and Bruns 1993, White et al. 1990) with the following thermocycler conditions: 94 ºC for 3 min; 30 cycles of 94 ºC for 30 sec, 55 ºC for 60 sec, 72 ºC for 60 sec, and 72 ºC for 5 min as per Osmundson et al. (2013). We tested mini-barcoding on specimens collected between 1980 and 2011 (n = 13), and so this protocol was exclusive to the specimens with which the DNA kits were tested. Mini-barcodes were only attempted on DNA extracted with the GBO kit. Results DNA isolation kit performance and age-specific bar coding success The GBO kit outperformed the MBO kit in the acquisition of full barcodes from fungal herbarium specimens from 1975. There was a relatively low rate of PCR success (46%, 18 of 39) from the GBO kit; however, there was a relatively high conversion rate to sequencing success (18%), as 7 of 39 attempted samples yielded a full ITS barcode. Comparatively, the MBO kit had a relatively high rate of PCR success (77%, 23 of 30), as most samples produced a band on an agarose gel after PCR. However, the MBO kit samples had a very low conversion rate to sequence success, as they did not yield any identifiable barcodes (0 of 30). The GBO kit outperformed the MBO kit with specimens from 1975 in terms of overall barcoding success rate; thus, we used the GBO kit exclusively with all other specimens from the 1980s, 1990s, and 2011. There was a correlation between specimen age and likelihood of full barcoding success (Fig. 1). Specimens from the 1980s were 25% successful (1 of 4) for full barcodes and 75% successful (3 of 4) for mini-barcodes. Specimens from the 1990s were 40% successful (2 of 5) for full barcodes and 100% successful (5 of 5) for mini-barcodes. Specimens from 2011 were 75% successful (3 of 4) for full barcodes and 100% successful (4 of 4) for mini-barcodes. A linear regression (r2 = 0.96, P = 0.02) showed that as specimen age increased, there was a decreased likelihood of obtaining a useful barcode. Northeastern Naturalist 470 A.P. Young, R.C. Evans, R. Newell, and A.K. Walker 2019 Vol. 26, No. 3 Full barcode and mini-barcode performance Specimens collected in 1980 or later were mini-barcoded to determine if mini-barcodes could reliably identify fungal herbarium specimens, and we compared success rate to that of full barcodes. We obtained mini-barcodes more often (92% sequencing success rate; 12 of 13) with no decline in identification accuracy compared to full barcodes (46% sequencing success rate; 6 of 13) for specimens collected between 1980 and 2011 (Fig. 2). There was a high degree of identification congruency between the original herbarium labels and the identifications made based on a >97% match to NCBI GenBank reference sequences (83% for mini-barcodes and 71% for full barcodes). In cases where we obtained both full barcodes and mini-barcodes from the same specimen, both barcodes always produced the same top matches from GenBank. We also searched all full and mini-barcodes against the UNITE database (Nilsson et al. 2018), and all identifications matched those obtained from GenBank. Sequences generated in this study are deposited in GenBank under accession numbers MH4655077–MH4655094 (Appendix A). Duplicate sequences are not permitted in GenBank; thus, for full and mini-barcodes of the same specimen, only the full barcode has a GenBank accession number. Discussion We present here an approach to the DNA barcoding of preserved fungal herbarium specimens from the E.C. Smith Herbarium (ACAD). We have found that our protocol yielded a greater success rate compared to other protocols employed for this purpose. Mini- and full barcodes successfully corroborated the original Figure 1. Full barcoding success rates on mixed samples of ascomycetes, basidiomycetes, and lichens from 4 time periods. Black bars indicate that we successfully obtained barcode sequences and gray bars indicate failure. For 1970–1979, n = 39; for 1980–1989, n = 4; for 1990–1999, n = 5; for 2011, n = 4. Northeastern Naturalist Vol. 26, No. 3 A.P. Young, R.C. Evans, R. Newell, and A.K. Walker 2019 471 morphological identification of each herbarium specimen (Fig. 2), consistent with results of Osmundson et al. (2013). We have also found that mini-barcodes can be utilized to identify a specimen when full barcodes cannot be obtained. Our research has implications for improving our identifications of field-collected fungi from Nova Scotia, as well as for improving worldwide barcoding projects such as Encyclopedia of Life and International Barcode of Life. The fungal component of these projects relies heavily on herbarium material, and an optimized protocol for accessing their barcode sequences will allow the mycological community to increase the representation of fungi in global biodiversity initiatives. Barcoding success in relation to specimen age It is well documented that older fungal specimens are more difficult to barcode than recent collections (Dabney et al. 2013, Dentinger et al. 2010, Osmundson et al. 2013). The same effects have also been observed in plants (de Vere et al. 2012, Kress et al. 2005, Kuzmina et al. 2017). This barrier is not necessarily a result of specimen degradation but may be an example of improvements in preservation techniques over time, as barcoding success is highly reliant on proper preservation of specimens (Rogers and Bendich 1985, Särkinen 2012). Although many full barcoding protocols can achieve very high success rates from fresh materials, success rates are still very low in preserved fungal herbarium specimens, especially those that are more than 30 y old (Osmundson et al. 2013, Truong et al. 2017). Figure 2. Comparison of performance of full (black bars, n = 13) and mini- (gray bars, n = 13) barcoding methods in terms of success rate of DNA sequence acquisition (sequence positive) and congruency between obtained identities from GenBank and original herbarium labels (ID congruency). Northeastern Naturalist 472 A.P. Young, R.C. Evans, R. Newell, and A.K. Walker 2019 Vol. 26, No. 3 To our knowledge, our protocol yielded higher success rates than other published protocols when working with preserved fungal specimens older than 30–40 y. We observed a full barcoding success rate of 18% in specimens over 40 y old (Fig. 1). Therefore, this method of DNA barcoding should be considered for small-scale projects involving fungal herbarium specimens, especially those 30 y or more in age. Comparison of mini-barcode and full barcode performance In our study, mini-barcodes (~300 bp) proved to be more accessible from fungal herbarium specimens than full barcodes (~700 bp). Whereas every specimen that yielded a full barcode also yielded a mini-barcode (Fig. 2, Fig. 3), several specimens produced a mini-barcode but failed to produce a full barcode. Thus, mini-barcoding demonstrated a higher sequencing success rate. It has been documented that mini-barcoding can be more reliable with specimens with ancient or highly degraded DNA (Erickson et al. 2017, Hajibabaei et al. 2006, Meusnier et al. 2008, Van Houdt et al. 2010). Truong et al. (2017) found that when working with freshly collected specimens, ITS barcoding success rates increased from 80% to 90% when shifting from full barcoding to partial ITS barcoding (ITS1 + 5.8S only). We documented an increase (46% to 92%) from full barcoding to mini-barcoding (ITS1 only). The increased success rate of mini-barcodes may be attributed to the shorter length of ITS1 DNA fragments; they contain fewer sites for potential mutation or strand breakage (Dabney et al. 2013). Thus, the shorter fragments are more likely to remain intact to produce a high-quality PCR amplicon. Figure 3. Comparison of success rates for full (black bars) and mini- (gray bars) barcode sequencing on mixed samples of ascomycetes and basidiomycetes based on herbarium specimen age. For each of full barcoding and mini-barcoding: 1980–1989, n = 4; for 1990– 1999, n = 5; for 2011, n = 4. Northeastern Naturalist Vol. 26, No. 3 A.P. Young, R.C. Evans, R. Newell, and A.K. Walker 2019 473 There was a high degree of congruency between the identifications obtained from GenBank and the original herbarium labels (71% for full barcode, n = 13; 83% for mini-barcode, n = 13). Both mini- and full barcodes were able to identify the fungal herbarium specimens to the same degree. Whenever we obtained the mini- and full barcode sequences for a specimen, the 2 barcodes always returned the same top matches from GenBank. However, as mini-barcoding had a higher success rate overall, mini-barcodes could be used to identify more specimens to create the higher identification rate. The few sequence-based identification discrepancies we encountered between herbarium labels and GenBank matches occurred for genera or species that have been revised during prior molecular phylogenetic studies, e.g., the genera Lactarius and Lactifluus (Verbeken and Nuytinck 2013). Thus, both mini- and full barcodes could identify our herbarium specimens with equal accuracy when both were obtained. Hajibabaei et al. (2006) found that mini-barcodes were effective in the identification of moth and wasp museum specimens and concluded that mini-barcoding was a suitable alternative to full barcoding. Erickson et al. (2017) also found that mini-barcodes based on the rbcL gene were effective in plant identification, as they captured 90% of the identification power of full barcodes at less than one third of the size. Full barcodes may provide a higher resolution to compare specimens that are closely related. Mini-barcoding, however, offers a simple solution for the identification of preserved specimens with degraded genomic DNA that is not suitable for full barcoding. Importance of preservation method Historically, fungal specimens were chemically treated in preparation for longterm storage (Taylor and Swann 1994). The chemical preservation techniques included harsh fixatives or alcohol. However, these methods have since been identified to induce post-mortem DNA damage and are no longer recommended (Särkinen et al. 2012, Zimmermann et al. 2008). Many of the specimens used in this research are from 1975 and were dried over a course of several weeks at room temperature (Boland and Grund 1979). We now know that a slow and inefficient drying process can lead to undue oxidative stress on cells, which results in cell death and reduces the available DNA in the specimen (Staats et al. 2011). Thus, the 1975 specimens likely contained much lower-quality genomic DNA; this was reflected by the lower rates of sequencing success compared to more recently collected specimens. As DNA barcoding has grown in popularity since the 1990s, the method of preservation has been emphasized as an important aspect of the barcoding process (Erkens et al. 2008, Kuzmina et al. 2017, Särkinen et al. 2012, Staats et al. 2011). It is currently recognized that importance should be placed on the method of specimen preservation to retain the structural integrity of its DNA (Taylor and Swann 1994). There is strong evidence that controlled desiccation can preserve fungal specimens with less damage done to the DNA. Wang et al. (2017) assessed the effects of drying method on DNA recovery in mushrooms. Those authors examined 8 drying methods in the species Agaricus bisporus (J.E. Lange) Imbach (Portabella) and Trametes versicolor (L.) Lloyd (Turkey Tail) and ultimately concluded that oven Northeastern Naturalist 474 A.P. Young, R.C. Evans, R. Newell, and A.K. Walker 2019 Vol. 26, No. 3 drying at 70 °C for 3–4 h is the most time-efficient method to preserve DNA for downstream application. However, these methods dehydrate the mushrooms more than other methods and thus may not be equally suitable for long-term morphological identification. Therefore, it may be prudent to preserve mushrooms based on their intended function and specially preserve specimens destined for DNA barcoding purposes. Role of PCR inhibitors in preserved fungal tissue Preserved herbarium specimens are known to potentially contain a variety of inhibitors including tannins, humic acid, and fulvic acid (Särkinen et al. 2012). Tannins are naturally occurring plant polyphenolic compounds that inhibit PCR in concentrations as low as 0.1 μg/mL when they bind to macromolecules including DNA and proteins (Arnold and Targett 2002, Kreader 1996, Tichopad et al. 2010). Tannins were likely present in the cordgrass that housed the fruiting bodies of all ascomycete specimens examined in this study. Other known inhibitors, humic acid and fulvic acid, were likely present in the soil that contaminated many of the basidiocarps sampled, despite efforts to clean the surface of each specimen prior to DNA extraction (Lorenz 2012). These ubiquitous inhibitors are present in the tissue of both fungal and plant herbarium specimens and should be managed when possible. There are measures which can be taken to minimize the effects of PCR inhibitors from preserved tissue. Strong evidence supports the use of BSA in PCR to amplify preserved herbarium DNA as well as fossilized plant DNA and ancient animal DNA (Pääbo 1989, Rohland and Hofreiter 2007, Savolainen et al. 1995). BSA absorbs polyphenols and other inhibitors to free the DNA template molecules and allows the PCR to proceed efficiently (Kreader 1996, Opel et al. 2010, Weising et al. 1994). The PCR protocol used in this research incorporated high concentrations of BSA and MgCl2; however, the concentrations were not optimized. Further research into PCR additives could potentially uncover the best concentrations to manage the presence of inhibitors. Commercial kits are also available to purify the DNA template prior to amplification. These kits are effective in the removal of inhibitors; however, a loss of DNA material is inevitable (Särkinen et al. 2012). Thus, this strategy may not be viable when small amounts of DNA are recovered from the specimen. Acknowledgments We thank B. Robicheau for his assistance with editing the manuscript and figure development, Q. Eggertson (AAFC Ottawa) for technical advice, and Genome Quebec Innovation Centre (McGill University) for DNA sequencing. We acknowledge support of this study from the Nova Scotia Strategic Cooperative Education Incentive as well as the Acadia University Thomas Raddall Research Fund in Biology and University Research Fund. We thank 2 anonymous reviewers and the manuscript editor, Dr. Adrienne Kovach, for their critical feedback. Literature Cited Arnold, T.M., and N.M. Targett. 2002. Marine tannins: The importance of a mechanistic framework for predicting ecological roles. Journal of Chemical Ecology 28:1919–1934. Northeastern Naturalist Vol. 26, No. 3 A.P. Young, R.C. Evans, R. Newell, and A.K. Walker 2019 475 Begerow. D., R. Bauer, and F. Oberwinkler. 1997. Phylogenetic studies on large subunit ribosomal DNA sequences of smut fungi and related taxa. Canadian Journal of Botany 75(12):2045–2066. Begerow, D., H. Nilsson, M. Unterseher, and W. Maier. 2010. Current state and perspectives of fungal DNA barcoding and rapid identification procedures. Applied Microbiology and Biotechnology 87(1):99–108. Bemmann, W. 1981. Dimorphism of fungi: Review of the literature. Zentralblatt fur Bakteriologie 136:369–416. Benson, D.A., I. Karsch-Mizrachi, D.J. Lipman, J. Ostell, and D.L. Wheeler. 2005. Gen- Bank. Nucleic Acids Research 33:D34–D38. DOI:10.1093/nar/gki063. Boland, G.J., and D.W. Grund. 1979. Fungi from the salt marshes of Minas Basin, Nova Scotia. Proceedings of the Nova Scotian Institute of Science 29(4):393–404. Brock, P.M., H. Döring, and M.I. Bidartondo. 2009. How to know unknown fungi: The role of a herbarium. New Phytologist 181:719–724. Bruns, T.D., R. Fogel, and J.W. Taylor. 1990. Amplification and sequencing of DNA from fungal herbarium specimens. Mycologia 82:175–184. Cubero, O., A. Crespo, J. Fatehi, and P. Bridge. 1999. DNA extraction and PCR amplification method suitable for fresh, herbarium-stored, lichenized, and other fungi. Plant Systematics and Evolution 216:243–249. Dabney, J., M. Meyer, and S. Pääbo. 2013. Ancient DNA damage. Cold Spring Harbor Perspectives in Biology 5(7). DOI:10.1101/cshperspect.a012567. Dentinger, B.T.M., S. Margaritescu, and J-M. Moncalvo. 2010. Rapid and reliable highthroughput methods of DNA extraction for use in barcoding and molecular systematics of mushrooms. Molecular Ecology Resources 10(4):628–633. DOI:10.1111/j.1755- 0998.2009.02825.x. de Vere, N., T.C.G. Rich, C.R. Ford, S.A Trinder, C. Long, C.W. Moore, D. Satterthwaite, H. Davies, J. Allainguillaume, S. Ronca, T. Tatarinova, H. Garbett, K. Walker, and M.J. Wilkinson. 2012. DNA barcoding the native flowering plants and conifers of Wales. PLOS ONE 7(6):e37945. DOI:10.1371/journal.pone.0037945. Drábková, L. 2014. DNA extraction from herbarium specimens. Pp. 69–84, In P. Besse (Ed.). Molecular Plant Taxonomy. Humana Press, New York, NY. 402 pp. Erickson, D.L., E. Reed, P. Ramachandran, N.A. Bourg, W.J. McShea, and A. Ottesen. 2017. Reconstructing an herbivore’s diet using a novel rbcL DNA mini-barcode for plants. AoB PLANTS 9(3):plx015. DOI:10.1093/aobpla/plx015. Erkens, R.H.J., H. Cross, J.W. Maas, K. Hoenselaar, and L.W. Chatrou. 2008. Assessment of age and greenness of herbarium specimens as predictors for successful extraction and amplification of DNA. Blumea–Biodiversity, Evolution, and Biogeography of Plants 53(2):407–428. Forin, N., S. Nigris, S. Voyron, M. Girlanda, A. Vizzini, G. Casadoro, and B. Baldan. 2018. Next-generation sequencing of ancient fungal specimens: The case of the Saccardo Mycological Herbarium. Frontiers in Ecology and Evolution 6:129. doi:10.3389/ fevo.2018.00129. Gardes, M., and T.D. Bruns. 1993. ITS primers with enhanced specificity for basidiomycetes: Application to the identification of mycorrhizae and rusts. Molecular Ecology 2:113–118. Hajibabaei, M., and C. McKenna. 2012. DNA mini-barcodes. Methods in Molecular Biology 858:339–353. DOI:10.1007/978-1-61779-591-6_15. Northeastern Naturalist 476 A.P. Young, R.C. Evans, R. Newell, and A.K. Walker 2019 Vol. 26, No. 3 Hajibabaei, M., M.A. Smith, D.H. Janzen, J.J. Rodriguez, J.B. Whitfield, and P.D.N Hebert. 2006. A minimalist barcode can identify a specimen whose DNA is degraded. Molecular Ecology Notes 6(4):959–964. DOI:10.1111/j.1471-8286.2006.01470.x. Hawksworth, D.L., and R. Lücking. 2017. Fungal diversity revisited: 2.2 to 3.8 million species. Microbiology Spectrum 5(4): FUNK-0052-2016. DOI:10.1128/microbiolspec. FUNK-0052-2016. Hebert, P.D.N., A. Cywinska, S.L. Ball, and J.R. deWaard. 2003. Biological identifications through DNA barcodes. Proceedings of the Royal Society of London B 270(1512):313– 321. doi:10.1098/rspb.2002.2218. Kelly, L.J., P.M. Hollingsworth, B.J. Coppins, C.J. Ellis, P. Harrold, J. Tosh, and R. Yahr. 2011. DNA barcoding of lichenized fungi demonstrates high identification success in a floristic context. New Phytologist 191(1):288–300. DOI:10.1111/j.1469- 8137.2011.03677.x. Kreader, C.A. 1996. Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein. Applied Environmental Microbiology 62:1102–1106. Kress, W.J., K.J. Wurdack, E.A. Zimmer, L.A. Weigt, and D.H. Janzen. 2005. Use of DNA barcodes to identify flowering plants. PNAS 102(23): 8369–8374. DOI:10.1073/ pnas.0503123102. Kuzmina, M.L., T.W.A. Braukmann, A.J. Fazekas, S.W. Graham, S.L. Dewaard, A. Rodrigues, B.A. Bennett, T.A. Dickinson, J.M. Saarela, P.M. Catling, S.G. Newmaster, D.M. Percy, E. Fenneman, A. Lauron-Moreau, B. Ford, L. Gillespie, R. Subramanyam, J. Whitton, L. Jennings, D. Metsger, C.P. Warne, A. Brown, E. Sears, J.R. Dewaard, E.V. Zakharov, and P.D.N. Hebert. 2017. Using herbarium-derived DNAs to assemble a large-scale DNA barcode library for the vascular plants of Canada. Applications in Plant Sciences 5(12):1700079. DOI:10.3732/apps.1700079. Larena, I., O. Salazar, V. González, M.C. Julián, and V. Rubio. 1999. Design of a primer for ribosomal DNA internal transcribed spacer with enhanced specificity for ascomycetes. Journal of Biotechnology 75:187–194. Lorenz, T.C. 2012. Polymerase chain reaction: Basic protocol plus troubleshooting and optimization strategies. Journal of Visualized Experiments 63:e3998. Meusnier, I., G.A. Singer, J.-F. Landry, D.A. Hickey, P.D. Hebert, and M. Hajibabaei. 2008. A universal DNA mini-barcode for biodiversity analysis. BMC Genomics 9:214. DOI:10.1186/1471-2164-9-214. Nilsson, R.H., M. Ryberg, E. Kristiansson, K. Abarenkov, K.-H. Larsson, and U. Kõljalg. 2006. Taxonomic reliability of DNA sequences in public sequence databases: A fungal perspective. PLOS ONE 1:e59. DOI:10.1371/journal.pone.0000059. Nilsson, R.H., K.-H. Larsson, A.F.S. Taylor, J. Bengtsson-Palme, T.S. Jeppesen, D. Schigel, P. Kennedy, K. Picard, F.O. Glöckner, L. Tedersoo, I. Saar, U. Kõljalg, and K. Abarenkov. 2018. The UNITE database for molecular identification of fungi: Handling dark taxa and parallel taxonomic classifications. Nucleic Acids Research 47:D259– D264. DOI:10.1093/nar/gky1022. Opel, K.L., D. Chung, and B.R. McCord. 2010. A study of PCR inhibition mechanisms using real time PCR. Journal of Forensic Sciences 55:25–33. Osmundson, T.W., V.A. Robert, C.L. Schoch, L.J. Baker, A. Smith, G. Robich, L. Mizzan, and M.M. Garbelotto. 2013. Filling gaps in biodiversity knowledge for macrofungi: Contributions and assessment of a herbarium collection DNA barcode sequencing project. PLOS One 8(4): e62419. D0I:10.1371/journal.pone.0062419. Pääbo, S. 1989. Ancient DNA: Extraction, characterization, molecular cloning, and enzymatic amplification. Proceedings of the National Academy of Sciences USA 86:1939–1943. Northeastern Naturalist Vol. 26, No. 3 A.P. Young, R.C. Evans, R. Newell, and A.K. Walker 2019 477 Raja, H.A., T.R. Baker, J.G. Little, and N.H. Oberlies. 2017. DNA barcoding for identification of consumer-relevant mushrooms: A partial solution for product certification? Food Chemistry 214:383–392. DOI:10.1016/j.foodchem.2016.07.052. Rogers, S.O., and A.J. Bendich. 1985. Extraction of DNA from milligram amounts of fresh, herbarium and mummified plant tissues. Plant Molecular Biology 5(2):69–76. DOI:10.1007/BF00020088. Rohland, N., and M. Hofreiter. 2007. Ancient DNA extraction from bones and teeth. Nature Protocols 2:1756–1762. Särkinen, T., M. Staats, J.E. Richardson, R.S. Cowan, and F.T. Bakker. 2012. How to open the treasure chest? Optimising DNA extraction from herbarium specimens. PLOS One 7(8):e43808. DOI:10.1371/journal.pone.0043808. Savolainen, V., P. Cuénoud, R. Spichiger, M.D.P. Martinez, M. Crèvecoeur, and J-F. Manen. 1995. The use of herbarium specimens in DNA phylogenetics: Evaluation and improvement. Plant Systematics and Evolution 197:87–98. Schoch, C.L., K.A. Seifert, S. Huhndorf, V. Robert, J.L. Spouge, C.A. Levesque, and W. Chen. 2012. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for fungi. Proceedings of the National Academy of Sciences USA 109:6241–6246. Staats, M., A. Cuenca, J.E. Richardson, R. Vrielink-van Ginkel, G. Petersen, O. Seberg, and F.T. Bakker. 2011. DNA damage in plant herbarium tissue (herbarium DNA damage). PLOS One 6:e28448. Taylor, J.W., and E.C. Swann. 1994. DNA from Herbarium Specimens. Pp. 166–181, In B. Herrmann and S. Hummel (Eds.). Ancient DNA. Springer, New York, NY. 284 pp. DOI:10.1007/978-1-4612-4318-2_11. Tichopad, A., T. Bar, L. Pecen, R.R. Kitchen, M. Kubista, and M.W. Pfaffl. 2010. Quality control for quantitative PCR based on amplification compatibility test. Methods 50:308–312. Truong, C., A.B. Mujic, R. Healy, F. Kuhar, G. Furci, D. Torres, T. Niskanen, P.A. Sandoval- Leiva, N. Fernández, J.M. Escobar, A. Moretto, G. Palfner, D. Pfister, E. Nouhra, R. Swenie, M. Sánchez-García, P.B. Matheny, and M.E. Smith. 2017. How to know the fungi: Combining field inventories and DNA-barcoding to document fungal diversity. New Phytologist 214(3):913–919. DOI:10.1111/nph.14509. Van Houdt, J.K.J., F.C. Breman, M. Virgilio, and M.D. Meyer. 2010. Recovering full DNA barcodes from natural history collections of Tephritid fruitflies (Tephritidae, Diptera) using mini barcodes. Molecular Ecology Resources 10(3):459–465. DOI:10.1111/ j.1755-0998.2009.02800.x. Verbeken, A., and J. Nuytinck. 2013. Not every milkcap is a Lactarius. Scripta Botanica Belgica 51:162–168. Wang, S., Liu, Y., and J. Xu. 2017. Comparison of different drying methods for recovery of mushroom DNA. Scientific Reports 7:3008. Available online at https://www.nature.com/ articles/s41598-017-03570-7. Weising, K., H. Nybom, M. Pfenninger, K. Wolff, and W. Meyer. 1994. DNA fingerprinting in plants and fungi. CRC Press, Boca Raton, FL. 336 pp. White, T.J., T.D. Bruns, S.B. Lee, and J.W. Taylor. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pp. 315–322, In M.A. Innis, D.H. Gelfand, J.J. Sninsky, and T.J. White (Eds.). PCR Protocols: A Guide to Methods and Applications. Academic Press, Inc., Cambridge, MA. 481 pp. Xu, J. 2016. Fungal DNA barcoding. Genome 59(11):913–932. DOI:10.1139/gen-2016-0046. Northeastern Naturalist 478 A.P. Young, R.C. Evans, R. Newell, and A.K. Walker 2019 Vol. 26, No. 3 Yahr, R., C.L. Schoch, and B.T.M. Dentinger. 2016. Scaling up discovery of hidden diversity in fungi: Impacts of barcoding approaches. Philosophical Transactions of the Royal Society B 371:20150336. DOI:10.1098/rstb.2015.0336. Zimmermann, J., M. Hajibabaei, D.C Blackburn, J. Hanken, E. Cantin, J. Posfai, and T.C. Evans. 2008. DNA damage in preserved specimens and tissue samples: A molecular assessment. Frontiers in Zoology 5:18. DOI:10.1186/1742-9994-5-18. Northeastern Naturalist Vol. 26, No. 3 A.P. Young, R.C. Evans, R. Newell, and A.K. Walker 2019 479 Appendix A. E.C. Smith Herbarium (ACAD) fungal specimens examined during the first herbarium barcoding project at Acadia University, Wolfville, NS, Canada. Included are all 1975 samples tested with the GBO kit (n = 39) and the MBO kit (n = 30). All samples from 1980 onward are also listed (n = 26). For samples that achieved PCR success, data on the DNA quality metrics are provided (yield, 260/280 nm absorbance ratio, 260/230 nm absorbance ratio). For samples that achieved PCR success and sequencing success, the sequences were deposited and GenBank accession numbers are provided. DNA Year PCR Barcode yield A260/ A260/ GenBank Scientific name ACAD ID Kit collected success type (ng/μL) 280 230 accession Alternaria maritima 19600F MBO 1975 Yes Full 20.0 2.00 0.50 Austroboletus gracilis (Peck) Wolfe 11344F GBO 1975 Yes Full 303.0 1.21 1.83 MH465078 Boletus huronensis A.H. Smith and Thiers 11362F MBO 1975 Yes Full 22.5 1.80 0.43 Boletus huronensis 11362F GBO 1975 No Full Boletus inedulis (Murrill) Murrill 11356F MBO 1975 Yes Full 12.5 2.50 0.24 Boletus inedulis 19643F MBO 1975 Yes Full 26.4 1.28 1.62 Boletus inedulis 11356F GBO 1975 No Full Boletus pseudopeckii A.H. Sm. & Thiers 11365F GBO 1975 Yes Full 20.0 2.67 1.14 MH465077 Boletus subvelutipes Peck 11355F MBO 1975 No Full Boletus subvelutipes 11363F MBO 1975 No Full Boletus subvelutipes 11355F GBO 1975 No Full Buergenerula spartinae Kohlm. & R.V. Gessner 19562F MBO 1975 Yes Full 22.4 1.37 1.62 Buergenerula spartinae 19572F GBO 1975 Yes Full 72.5 1.45 0.53 Buergenerula spartinae 19577F GBO 1975 Yes Full 55.0 1.57 0.50 Buergenerula spartinae 19581F GBO 1975 Yes Full 298.0 1.51 0.70 Buergenerula spartinae 19585F GBO 1975 Yes Full 70.0 1.75 0.85 Buergenerula spartinae 19562F GBO 1975 Yes Full 60.0 1.50 0.20 Buergenerula spartinae 19580F GBO 1975 No Full Chaetomium sp. 19620F MBO 1975 Yes Full 188.0 1.07 1.56 Chaetomium sp. 19620F GBO 1975 Yes Full 45.0 2.57 0.86 MH465080 Entoloma sp. 16914F GBO 1995 Yes Full 31.7 1.71 2.14 MH465086 Entoloma sp. 16914F GBO 1995 Yes Mini 31.7 1.71 2.14 Northeastern Naturalist 480 A.P. Young, R.C. Evans, R. Newell, and A.K. Walker 2019 Vol. 26, No. 3 DNA Year PCR Barcode yield A260/ A260/ GenBank Scientific name ACAD ID Kit collected success type (ng/μL) 280 230 accession Gyroporus cyanescens (Bull.) Quél. 11351F GBO 1975 Yes Full 905.0 2.13 2.03 Halosphaeria mediosetigera Cribb & J.W. Cribb 19570F MBO 1975 Yes Full 9.1 1.71 1.38 Halosphaeria mediosetigera 19570F GBO 1975 No Full Harrya chromipes (Frost) Halling, Nuhn, 11356BF MBO 1975 Yes Full 20.0 1.60 0.53 Osmundson & Manfr. Binder Hemileccinum subglabripes (Peck) Halling 11353F MBO 1975 Yes Full 27.5 1.38 0.44 Humicola alopallonella Meyers & R.T. Moore 19607F MBO 1975 Yes Full 42.5 0.94 0.39 Hyde & Mouzouras Humicola alopallonella 19607F GBO 1975 No Full Hydnellum diabolus Banker 14888F GBO 1983 Yes Mini 51.4 1.82 2.11 MH465088 Hydnellum diabolus 14888F GBO 1983 No Full Hydnum imbricatum L. 13955F GBO 1981 No Full Hydnum imbricatum 13955F GBO 1981 No Mini Hydnum repandum L. 19796F GBO 2011 Yes Full 18.9 1.66 2.08 MH465093 Hydnum repandum 19796F GBO 2011 Yes Mini 38.7 1.84 2.12 Hygrophoropsis aurantiaca (Wulfen) Maire 16938F GBO 1995 Yes Mini 26.4 1.63 1.87 MH465089 Hygrophoropsis aurantiaca 16938F GBO 1995 No Full Lactarius volemus (Fr.) Fr. 13941F GBO 1981 Yes Mini 28.9 1.68 1.91 MH465087 Lactarius volemus 13941F GBO 1981 No Full Leptosphaeria albopunctata (Westend.) Sacc. 19614F MBO 1975 No Full Leptosphaeria connecta Kohlm. 19591F MBO 1975 Yes Full 27.1 1.22 1.69 Leptosphaeria marina Ellis & Everh. 19558F MBO 1975 No Full Leptosphaeria marina 19558F GBO 1975 No Full Leptosphaeria obiones (P. Crouan & H. Crouan) 19574F GBO 1975 No Full Sacc. Leptosphaeria orae-maris Linder 19630F MBO 1975 Yes Full 17.5 1.75 0.37 Leptosphaeria orae-maris 19630F GBO 1975 No Full Leptosphaeria pelagica E.B.G. Jones 19584F MBO 1975 Yes Full 15.0 1.50 0.38 Northeastern Naturalist Vol. 26, No. 3 A.P. Young, R.C. Evans, R. Newell, and A.K. Walker 2019 481 DNA Year PCR Barcode yield A260/ A260/ GenBank Scientific name ACAD ID Kit collected success type (ng/μL) 280 230 accession Leptosphaeria pelagica 19584F GBO 1975 No Full Lobaria pulmonaria (L.) Hoffm. ECS036547 GBO 1990 Yes Mini 14.5 1.61 1.84 MH465090 Lobaria pulmonaria ECS036547 GBO 1990 No Full Lulworthia sp. 19560F MBO 1975 Yes Full 18.8 1.27 1.79 Lulworthia spp. 19575F GBO 1975 Yes Full 30.0 2.00 1.20 Lulworthia spp. 19578F GBO 1975 Yes Full 30.0 2.40 0.67 Lulworthia spp. 19569F GBO 1975 No Full Lulworthia spp. 19560F GBO 1975 No Full Lulworthia spp. 19561F GBO 1975 No Full Lycoperdon flavotinctum Bowerman 19793F GBO 2011 Yes Full 29.4 1.88 2.05 MH465091 Lycoperdon flavotinctum 19793F GBO 2011 Yes Mini 18.5 1.62 1.93 Melanoleuca fumosolutea (Peck) Murrill 19809F GBO 2011 No Full Melanoleuca fumosolutea 19809F GBO 2011 Yes Mini 52.6 1.74 2.08 MH465094 Nais inornata Kohlm. 19571F MBO 1975 No Full Nais inornata 19571F GBO 1975 No Full Passeriniella obiones (P. Crouan & H. Crouan) 19559F MBO 1975 Yes Full 22.5 2.25 0.33 K.D. Passeriniella obiones 19559F GBO 1975 No Full Phaeosphaeria typharum (Desm.) L. Holm 19563F MBO 1975 Yes Full 19.3 1.54 1.73 Phaeosphaeria typharum 19568F GBO 1975 Yes Full 5.0 1.51 0.18 Phaeosphaeria typharum 19587F GBO 1975 Yes Full 17.5 2.33 0.35 Phaeosphaeria typharum 19565F GBO 1975 No Full Phaeosphaeria typharum 19579F GBO 1975 No Full Phaeosphaeria typharum 19582F GBO 1975 No Full Phaeosphaeria vagans (Niessl) O.E. Erikss. 19631F MBO 1975 Yes Full 7.5 1.92 0.55 Pholiota muelleri Pholiota squarrosa (Vahl) . 16913F GBO 1995 Yes Full 17.1 1.68 2.02 MH465085 P. Kumm Pholiota muelleri 16913F GBO 1995 Yes Mini 17.1 1.68 2.02 Northeastern Naturalist 482 A.P. Young, R.C. Evans, R. Newell, and A.K. Walker 2019 Vol. 26, No. 3 DNA Year PCR Barcode yield A260/ A260/ GenBank Scientific name ACAD ID Kit collected success type (ng/μL) 280 230 accession Phoma sp. 19573F MBO 1975 Yes Full 27.5 1.83 0.41 Phoma sp. 19573F GBO 1975 No Full Phoma sp. 19629F GBO 1975 Yes Full 80.0 2.29 1.07 MH465081 Phoma sp. 19634F GBO 1975 Yes Full 123.0 2.13 1.36 MH465082 Phoma sp. 19635F GBO 1975 Yes Full 47.5 1.90 1.00 MH465083 Phoma sp. 19636F GBO 1975 Yes Full 17.5 3.50 0.70 Pleospora spartinae (J. Webster & M.T. Lucas) 19624F MBO 1975 Yes Full 31.2 1.36 1.55 Apinis & Chesters Remispora hamata (Höhnk) Kohlm. 19616F GBO 1975 No Full Rhodocollybia maculata (Alb. & Schwein.) Singer 19711F GBO 2011 Yes Full 36.2 1.59 2.03 MH465092 Rhodocollybia maculata 19711F GBO 2011 Yes Mini 41.6 1.69 2.14 Russula emetica (Schaeff.) Pers. 16743F GBO 1995 Yes Mini 62.1 1.78 1.97 Russula emetica 16743F GBO 1995 No Full Sarcodon dissimulans K.A. Harrison 14878F GBO 1983 Yes Full 22.4 1.77 2.10 MH465084 Sarcodon dissimulans 14878F GBO 1983 Yes Mini 22.4 1.77 2.10 Stagnospora sp. 19642F MBO 1975 Yes Full 10.0 4.00 0.40 Sutorius eximius (Peck) Halling, Nuhn & 11347BF MBO 1975 Yes Full 14.4 2.09 0.68 Osmundson Sutorius eximius 11347F MBO 1975 No Full Sutorius eximius 11385F MBO 1975 Yes Full 15.0 2.00 0.32 Sutorius eximius 11347BF GBO 1975 No Full Tylopilus felleus (Bull.) P. Karst. 11348F GBO 1975 Yes Full 22.5 1.50 0.35 MH465079 Tylopilus pseudoscaber Secr. ex A.H. Sm. & Thiers 11349F MBO 1975 Yes Full 7.5 1.89 0.27 Xanthoconium separans (Peck) Halling & Both 11364F MBO 1975 No Full Northeastern Naturalist Vol. 26, No. 3 A.P. Young, R.C. Evans, R. Newell, and A.K. Walker 2019 483 Appendix B. DNA barcoding protocol for herbarium fungi. 1. Collect 5–25 mg tissue from hymenium of basidiomycete specimens or collect a minimum of 3 fruiting bodies from ascomycete specimens and place fungal tissue in sterile 1.5-mL microcentrifuge (MCF) tube. 2. Add ~1 mL of sterile distilled water to MCF tube and invert 20 times (specimen cleaning step). 3. Grind fungal tissue under liquid nitrogen using a sterile mortar and pestle and add to 500 μL Genomic Lysis Buffer. 4. Follow G-Biosciences Omniprep® protocol for fungal tissue steps 4–15 if following online protocol or fungal tissue steps 3–5 and solid tissue steps 5–14 if following kitsupplied booklet, including the mussel glycogen option. 5. Set up fungal rDNA ITS PCR reactions in 200 μL PuReTaq Ready-To-Go PCR Bead Tubes with total DNA obtained in step 4 as follows: Reaction component Volume Stock concentration ITS1-F 0.4 μL 10 μM Reverse primer* 0.4 μL 10 μM MgCl2 2.5 μL 25 mM BSA 2.5 μL 2 ng/μL H2O 14.2 μL Template DNA 5.0 μL 20–300 ng/μL Total 25.0 μL PCR reverse primer choice will depend on specimen genus and whether the desired target is a full barcode or mini-barcode: Ascomycete Basidiomycete Reverse (mini) ITS2 ITS2 Reverse (full) ITS4-A ITS4-B 6. Place reaction tubes in a thermocycler programmed with the following parameters: Step Full barcode Mini-barcode 1 95 ºC: 180 seconds 94 ºC: 180 seconds 2 95 ºC: 60 seconds 94 ºC: 30 seconds 3 52 ºC: 30 seconds 55 ºC: 60 seconds 4† 72 ºC: 60 seconds 72 ºC: 60 seconds 5 72 ºC: 600 seconds 72 ºC: 300 seconds †Repeat steps 2–4 for 35 cycles for full barcodes or 30 cycles for mini-barcodes Following PCR amplification of the ITS region, 5 μL product may be run on a 1% agarose gel containing 1 μL ethidium bromide per 10 mL buffer for 30 min at 100 v to assess amplification success.