sena masthead
SENA Home Staff & Editors For Readers For Authors

Phylogenetic Relationships in the North American Genus Pseudemys (Emydidae) Inferred from
Two Mitochondrial Genes

Thomas G. Jackson, Jr., David H. Nelson, and Ashley B. Morris

Southeastern Naturalist, Volume 11, Issue 2 (2012): 297–310

Full-text pdf (Accessible only to subscribers.To subscribe click here.)

 



Access Journal Content

Open access browsing of table of contents and abstract pages. Full text pdfs available for download for subscribers.

Issue-in-Progress: Vol. 25( 3) ... early view

Current Issue: Vol. 25 (2)
cover SENA 25(2)

Check out SENA's latest Monograph and current Special Issue in progress:

Monograph 13
SENA Monograph 13

Special Issue 13 in progress
SENA 24(special issue 13)

All Regular Issues

Monographs

Special Issues

 

submit

 

subscribe

 

JSTOR logoClarivate logoWeb of science logoBioOne logo EbscoHOST logoProQuest logo


2012 SOUTHEASTERN NATURALIST 11(2):297–310 Phylogenetic Relationships in the North American Genus Pseudemys (Emydidae) Inferred from Two Mitochondrial Genes Thomas G. Jackson, Jr.1, David H. Nelson1, and Ashley B. Morris2,* Abstract - Pseudemys turtles are an important component of southeastern North American aquatic ecosystems, but the relationships within the genus are poorly understood. Convergent morphology and apparent hybridization have complicated the identification of species boundaries and have resulted in numerous conflicting taxonomic treatments. We used mitochondrial DNA sequence data from the control region and cytochrome-b gene to address 1) the monophyly of currently recognized subgeneric clades (the cooters and the red-bellies), and 2) relationships within these two groups. A total of 91 specimens representing 8 Pseudemys and 3 outgroup taxa were sampled, and 36 distinct haplotypes were recovered. Pseudemys forms a well-supported monophyletic group, but relationships among species were not well resolved, such that support for the two subgeneric groupings was lacking. Furthermore, most taxa do not appear to be monophyletic, with the exception of P. gorzugi (Rio Grande Cooter) and P. texana (Texas Cooter), suggesting the possibility of mitochondrial introgression as a result of historic or continuing hybrid swarms across the range of the genus, or the lack of resolution may reflect a pattern of recent speciation. In light of recent molecular surveys in turtles, the utility of mitochondrial DNA in turtle systematics is also discussed . Emydid turtles represent a significant component of the fauna of the southeastern US. The family has been characterized as the most abundant, speciose, and ecologically diverse group of turtles in eastern North America (Ernst and Lovich 2009, Ernst et al. 1994, Stephens and Wiens 2003). Pseudemys is the second largest genus of emydid turtles in the subfamily Deirochelyinae. Members of this genus range from southeastern New Mexico eastward throughout the Florida peninsula and as far north as Massachusetts (Fig. 1). Eight species and two subspecies are currently recognized (Ernst and Lovich 2009): P. alabamensis (Alabama Red-bellied Turtle), P. concinna (subspecies P. c. concinna [Eastern River Cooter] and P. c. floridana [Florida Cooter]), P. gorzugi (Rio Grande Cooter), P. nelsoni (Florida Red-bellied Turtle), P. peninsularis (Peninsula Cooter), P. rubriventris (Northern Red-bellied Turtle), P. suwanniensis (Suwannee Cooter), and P. texana (Texas Cooter). Most of these species, with the exception of P. c. concinna, have restricted geographic distributions, and three are listed on the IUCN red list (2010) as either lower risk/near threatened (P. gorzugi and P. rubriventris) or endangered (P. alabamensis). The ability to properly plan for conservation and management practices is obviously dependent on a clear understanding of phylogenetic relationships, which is currently lacking in this group. 1Department of Biology, University of South Alabama, Mobile, AL 36688. 2Department of Biology, Middle Tennessee State University, Murfreesboro, TN 37132. *Corresponding author - ashley.morris@mtsu.edu. 298 Southeastern Naturalist Vol. 11, No. 2 Seidel (1994) recognized two species complexes on the basis of morphological and protein data: the red-bellies (P. rubriventris, P. nelsoni, and P. alabamensis) and the cooters (P. c. concinna, P. c. floridana, P. gorzugi, P. peninsularis, P. suwanniensis, and P. texana). Although Siedel and Ernst (1996) acknowledged that these two lineages (i.e., red-bellies and cooters) are distinct, historical problems with taxonomic nomenclature led them to avoid defining these two groups as subgenera. The red-bellies are characterized as having orange-reddish Figure 1. Geographic distribution of turtles in the genus Pseudemys: the red-bellies (subgenus Ptechemys; upper map) and the cooters (subgenus Pseudemys; lower map), as defined by Seidel (1994). Maps are redrawn from Ernst et al. (1994) and Conant and Collins (1998). 2012 T.G. Jackson, Jr., D.H. Nelson, and A.B. Morris 299 plastrons and a terminal maxillary notch bordered by tooth-like cusps. Turtles in this group also have a prefrontal arrow formed by the meeting of the sagittal head stripe with the supratemporal stripes (Carr and Crenshaw 1957, Ernst et al. 1994, Leary et al. 2003). While members of the cooter species complex may display some of the aforementioned characteristics of the red-bellies complex, no one species exhibits all of these characteristics entirely. Lydeard (1996) stated that “Pseudemys has been confounded by marked intra- and interspecific variation in morphological features often used to delineate a species.” Hence, there is considerable debate among many herpetologists as to the relationships among the taxa in the genus. Additionally, multiple researchers have found evidence for extensive hybrid swarms among species of the genus (Crenshaw 1965, Seidel and Palmer 1991), which could explain the extensive history of taxonomic revision described in Siedel and Ernst (1996). While there have been several molecular studies that have included one or more members of Pseudemys (Lydeard 1996, Stephens and Wiens 2003, Spinks et al. 2009, Wiens et al. 2010), no study has yet included all recognized taxa in the genus, nor has any study included more than one or a few accessions of each sampled taxon. Lydeard (1996) used mitochondrial DNA (mtDNA) cytochrome-b sequence data to determine if Mississippi individuals (n = 5) of P. alabamensis should be recognized as a distinct lineage from those in Alabama (n = 2). He included a small number of P. concinna (n = 6), P. c. floridana (n = 1), and P. nelsoni (n = 1) for comparison, but failed to resolve any relationships among the sampled taxa. Stephens and Wiens (2003) used morphology and the mtDNA cytochrome-b and control region to address phylogenetic relationships across Emydidae. They included seven Pseudemys taxa (P. alabamensis, P. concinna, P. gorzugi, P. nelsoni, P. peninsularis, P. rubriventris, and P. texana) but only had complete data for P. concinna. When all sampled taxa were included in a combined morphological and molecular analysis, relationships within the genus were poorly supported, with red-bellies (P. nelsoni, P. rubriventris, and P. alabamensis) supported by only 53% bootstrap support (BS) using maximum parsimony (MP), nested within the rest of the genus, which was only supported by 51% BS. Spinks et al. (2009) used mtDNA cytochrome-b and seven nuclear loci (nucDNA) to address relationships across the family, and they included four Pseudemys taxa (P. c. concinna, P. c. floridana, P. nelsoni, and P. peninsularis). Each data set (mtDNA and nucDNA) provided strong support for a monophyletic genus (≥0.95 bayesian posterior probability [BPP] and ≥90% BS for both MP and maximum likelihood [ML] analyses), but both were insufficient to address questions regarding infrageneric taxonomy due to the limited number of taxa included. Wiens et al. (2010) also used a combined mtDNA and nucDNA approach to the family, and included seven Pseudemys taxa (P. concinna, P. gorzugi, P. nelsoni, P. peninsularis, P. rubriventris, and P. texana). Their combined analysis showed strong support (BPP 1.00) for the red-bellies (P. rubriventris and P. nelsoni; P. alabamensis was not sampled), which were nested within the rest of the clade, as was suggested by Stephens and Wiens (2003). Considering the ecological importance and conservation concerns associated with Pseudemys, additional molecular work is warranted. Our primary objective 300 Southeastern Naturalist Vol. 11, No. 2 was to significantly improve sampling within and among taxa in this group to better address questions of relatedness. Previous molecular studies, which have largely focused on broad-scale systematics in turtles, have yet to include all recognized Pseudemys taxa and have typically included only one or two accessions per taxon. As a first attempt at assessing phylogenetic relationships within the genus, we chose to use mitochondrial DNA sequence data. In particular, we were interested in assessing the monophyly of currently recognized infrageneric groups (i.e., the red-bellies and the cooters), and relationships among taxa within these two groups. Here we present the results of two mtDNA genes for 86 accessions representing all recognized Pseudemys taxa, including subspecies, based on the taxonomy of Ernst and Lovich (2009). Materials and Methods Taxon sampling Samples were obtained through field trapping and from museum vouchers (Table 1). Field samples were collected between May and August 2008. Four sites in Alabama (Magnolia River [AL1], Blakeley River [AL2], Tensaw River [AL3], and Fowl River [AL4]) and one site in Mississippi (West Pascagoula River [MS1]) were chosen for sampling because they represented the full geographic range of P. alabamensis (Fig. 2), which is a federally endangered species and for which the authors have ongoing projects. With the exception of at the Blakeley River site, turtles collected during this study were captured using aquatic hoop traps. The traps were checked three days each week until a minimum of 8–10 specimens of P. alabamensis were collected from each site. Any other species of turtle trapped during this time were also sampled. Tail snips were taken from captured specimens, along with physical measurements and voucher photographs, and the turtles were released at the point of capture. The Blakeley River samples were obtained from previously frozen specimens from an ongoing highway mortality survey focused on P. alabamensis. Pseudemys species not obtained through field sampling at the five sites described above were obtained from museum voucher specimens. Bone fragments of P. nelsoni, P. peninsularis, P. rubriventris, and P. suwanniensis were obtained from the collections of the Florida Museum of Natural History (FLMNH), Gainesville, FL. Genomic DNA samples for P. texana and P. gorzugi were obtained from M.R.J. Forstner at Texas State University (TSU), San Marcos, TX. Blood samples of Chrysemys picta (Painted Turtle) and Trachemys scripta (Pond Slider) were obtained from S. Graham and G. Sorrell, Department of Biological Sciences, Auburn University, Auburn, AL, and these species were used as outgroups for phylogenetic reconstruction. An additional outgroup, Graptemys flavimaculata (Yellow-blotched Map Turtle), was obtained through the field sampling described above. Collection data for all samples included in phylogeny reconstruction are provided in Table 1. DNA extraction, amplification, and sequencing Total genomic DNA was extracted from tail snips and blood samples using the Qiagen DNeasy Blood and Tissue Kit (QIAGEN, Valencia, CA) following the manufacturer’s instructions. Bone sample preparation and DNA extraction were 2012 T.G. Jackson, Jr., D.H. Nelson, and A.B. Morris 301 Table 1. Specimens of each species surveyed for at two mitochondrial gene regions for phylogenetic reconstruction. Collection data n Haplotype Subgenus Ptechymys (red-bellies) Pseudemys alabamensis Baur, 1893 (Alabama Red-bellied Turtle) Magnolia River, Baldwin County, AL (AL1) 9 2, 4 Tensaw River, Baldwin County, AL (AL2) 6 3, 4 Blakely River, Baldwin County, AL (AL3) 7 4 Fowl River, Mobile County, AL (AL4) 6 4 Pascagoula River, Jackson County, MS (MS1) 11 1, 4 Pseudemys nelsoni Carr, 1938‡ (Florida Red-bellied Turtle) Monroe County, fl(FL1) 1 19 Alachua County, fl(FL2) 2 20 Pseudemys rubriventris (LeConte, 1830)‡ (Northern Red-bellied Turtle) York County, VA (VA1) 1 26 Virginia County, VA (VA2) 1 26 St. Mary’s County, MD (MD1) 1 27 Subgenus Pseudemys (cooters) Pseudemys concinna concinna (LeConte, 1830) (Eastern River Cooter) Magnolia River, Baldwin County, AL (AL1) 6 6, 7, 9, 11 Fowl River, Mobile County, AL (AL4) 2 5, 8 Pascagoula River, Jackson County, MS (MS1) 2 10 Pseudemys concinna floridana (LeConte, 1830) (Florida Cooter) Magnolia River, Baldwin County, AL (AL1) 5 13, 14, 16 Fowl River, Mobile County, AL (AL4) 2 12, 15 Pseudemys gorzugi Ward, 1984† (Rio Grande Cooter) Val Verde County, TX (TX1) 7 17, 18 Pseudemys peninsularis Carr, 1938‡ (Peninsula Cooter) Marion County, fl(FL3) 4 21, 22, 23, 24 Manatee County, fl(FL4) 1 25 Pseudemys suwanniensis Carr, 1937‡ (Suwannee Cooter) Suwannee County, fl(FL5) 1 28 Citrus County, fl(FL6) 2 29 Pseudemys texana Baur, 1893† (Texas Cooter) Hays County, TX (TX2) 8 30, 31 Outgroup taxa Chrysemys picta (Schneider, 1783)* (Painted Turtle) Macon County, AL (AL5) 3 32, 33 Graptemys flavimaculata Cagle, 1954 (Yellow-blotched Map Turtle) Pascagoula River, Jackson County, MS (MS1) 1 34 Trachemys scripta (Schoepff, 1792)* (Pond Slider) Macon County, AL (AL5) 2 35, 36 *Blood samples from S. Graham and G. Sorrell, Department of Biological Sciences, Auburn University, Auburn, AL. †Total genomic DNA samples from M.R.J. Forstner Tissue Collection, Department of Biology, University of Texas at San Marcos, TX. ‡Bone samples from Florida Museum of Natural History, University of Florida, Gainesville, FL. 302 Southeastern Naturalist Vol. 11, No. 2 completed at the University of Florida Interdisciplinary Center for Biotechnology Research (UF ICBR). Prior to DNA extraction, bone samples were prepared in a laminar flow hood to reduce any chance of cross-contamination of samples. All samples were first washed in a 6% bleach solution, followed by two washes in DNA-free water to remove any external contaminants. Samples were then placed in 2-ml of 0.5M EDTA (pH 8.0) on a rocking mixer for 3–6 days until there were signs of a gelatinous residue and opaqueness. Once the decalcification process was complete, DNA was extracted using a phenol/chloroform protocol (Kemp and Smith 2005) modified by B. Kimura (UF ICBR, unpubl. data). Two mitochondrial regions, the 5’ end of the control region and cytochrome-b, were selected for phylogenetic reconstruction. The primers selected for amplifi- cation of the control region (CR-DES1 and CR-DES2) were initially developed by Starkey et al. (2003) to study Chrysemys picta, a close relative of Pseudemys. Cytochrome-b primers (mt-A and CR-12H) were originally designed by Lenk and Wink (1997) for Emys orbicularis (L.) (European Pond Turtle; Emydidae). PCR amplification of the two regions followed the methods of Kozak et al. (2005) and Lenk et al. (1998), respectively. Annealing temperature was typically 55 °C, although 47 °C was used for poor quality DNA samples with problematic amplifi cations. Final concentrations for PCR reactions were the same for both regions: 1X PCR Buffer (Promega Corporation, Madison, WI), 3mM MgCl2, 200μM each Figure 2. Trapping locations for the present study. Selected locations were designed to cover the full geographic range of Pseudemys alabamensis. Sites are as follows: 1) Magnolia River, AL, 2) Blakeley River, AL, 3) Tensaw River, AL, 4) Fowl River, AL, and 5) Pascagoula River, MS. 2012 T.G. Jackson, Jr., D.H. Nelson, and A.B. Morris 303 dNTP, 200nM of each primer, and 1.25 U GoTaq polymerase (Promega Corporation, Madison, WI). Degradation of DNA from some bone samples required the development of internal primers (Table 2) and lower annealing temperatures (47 °C) for amplification of both gene regions. PCR cleanup and DNA sequencing were performed by High-Throughput Sequencing Solutions, a service of the High-Throughput Genomics Unit, Department of Genome Sciences, University of Washington, Seattle. All sequence data were deposited in GenBank (Accessions GQ395699-GQ395770). Phylogenetic analyses Sequences were edited and manually aligned by eye using Sequencher 4.2 (Gene Codes Corporation, 1991–2004). Bayesian analyses were conducted using Mr. Bayes 3.1.2 (Huelsenbeck and Ronquist 2001, Ronquist and Huelsenbeck 2003). Analysis of the combined data was performed, collapsing all individuals with the same haplotype to a single representative. To improve the fit of the substitution model to the data for Bayesian analysis, each gene region (control region and cytochrome-b) was treated as a separate partition. While the hierarchical likelihood ratio tests (hLRTs) are the most commonly employed model selection strategy, Posada and Buckley (2004) suggest that the Akaike information Table 2. Primers used to amplify two mitochondrial DNA regions (control region and cytochrome-b) for turtles used in this study. Primer name Primer sequence (5’ to 3’) Control region CR-DES 11 GCATTCATCTATTTTCCGTTAGCA R2822 TTAACTTGATGTGCCTGAAAAA L1612 CGAGAAATAAGCAACCCTTGTT R4102 AGGGCCTGAAGACACAGA L3442 TAACCTGGCATACGGTGGTT CR-DES 21 GGATTTAGGGGTTTGACGAGAAT CR-12H3 ATGAATGTACAATTATACATA Cytochrome-b mt-A3 CAACATCTCAGCATGATGAAACTTCG R2542 GGCTGAGAGGAGGTTGGTAA L1232 TATAAAGAAACCTGAAACACAGGAA R4272 CCTGTTGGGTTGTTTGATCC L3082 AGACAACGCAACCTTAACCC R5942 GTGGGGTAGATAGGGGGTTG L4082 GGATCAAACAACCCAACAGG R7232 TATGTAGGGCGGGCATTAAG L5402 AACCTTTTAGGGGACCCAGA R8002 TACTAGAAGGTTGGCGGTGAA R9732 GCGGCAGGGATAAGGATTA 1Primers from Starkey et al. (2003). 2Primers developed in the present study for amplification and sequencing of bone samples. L = left (or forward) primers, R = right (or reverse) primers; numbers refer to the nucleotide position of the primers start location in relation to CR-DES1 or mt-A. 3Primers from Lenk and Wenk (1997). 304 Southeastern Naturalist Vol. 11, No. 2 criterion (AIC) is a superior approach. Therefore, the AIC was implemented in Modeltest v3.6 (Posada and Crandall 1998) to determine an appropriate model of evolution for each gene region. The TIM+I model of nucleotide substitution was selected for the control region and the best-fit model of evolution for the cytochrome- b region was K81uf+I. Two independent runs were performed to evaluate the repeatability of estimating stationarity and convergence between runs. Each run was set for 5,000,000 generations, sampling one tree every 1000 generations. Stationarity was determined by plotting log likelihood scores against generation times, and sample points collected prior to stationarity were eliminated (i.e., as “burn-in”). The first 500 trees (10%) were discarded as burn-in, and the remaining 4500 trees were combined in a 50% majority rule consensus tree to estimate posterior probabilities for supported nodes. Results A total of 1450 bp from the control region and cytochrome-b gene region were amplified for analyses. Ninety-one specimens from the eight different species of Pseudemys and three outgroup taxa were used for analysis in this study. Of the 91 samples used, 36 different mtDNA haplotypes were recovered for the combined mitochondrial data set (Table 1). Within the genus Pseudemys (n = 86), there were 31 unique haplotypes, with no haplotypes shared across taxa. Pseudemys concinna concinna exhibited the greatest variation in sequence data with seven haplotypes represented from ten samples. Pseudemys alabamensis exhibited four haplotypes from 39 specimens used for analysis. One haplotype (haplotype 4) was common among all the populations of P. alabamensis sampled. A single private haplotype was observed in each of three sites (Magnolia River and Tensaw River in Alabama, Pascagoula River in Mississippi). Together, the outgroups accounted for five different haplotypes from six individuals. Three major clades were recovered with Bayesian analyses (Fig. 3): Clade 1 contains P. gorzugi only; Clade 2 includes individuals from all species except P. gorzugi, P. nelsoni, and P. texana; and Clade 3 includes individuals from all species except P. rubriventris and P. suwanniensis. Each of these major clades is supported by a Bayesian posterior probability of 0.98 or greater. Only P. gorzugi and P. texana appear to be monophyletic, while all other species are polyphyletic on the basis of the mitochondrial data presented here. There are no apparent geographic trends with respect to distribution of haplotypes, with one exception. Within Clade 3, there is a well-supported clade (PP 0.97) that includes all accessions of P. nelsoni and all but one accession of P. peninsularis. These individuals were all sampled from North Central Florida (see Table 1). The remaining accession of P. peninularis falls within a well-supported (PP 0.98) sub-clade of Clade 2 that also includes P. suwanniensis and P. concinna concinna. Missing data likely explains the inconsistent placement of this accession; 65 bp of the control region that exhibited variation in other members of the genus were missing in this accession. One accession of P. rubriventris from Maryland (MD1, haplotype 27) was recovered as unresolved between Clades 2 and 3; this accession had 186 bp of missing data in an otherwise variable region of cytochrome-b. Removal of these 2012 T.G. Jackson, Jr., D.H. Nelson, and A.B. Morris 305 twos accession did not significantly affect the positions of the remaining taxa in the reconstructed topologies (data not shown). Discussion Our results from two mtDNA regions show limited resolution among Pseudemys turtles. Most taxa are not recovered as monophyletic, and there is no support provided for currently recognized infrageneric groupings (i.e., red-bellies and cooters). Pseudemys gorzugi and P. texana, which are the most geographically distinct of all of the taxa, are the only recognized species recovered here as monophyletic (BPP 1.00 in each case), although the position of P. texana nested within the rest of the genus (BPP 1.00) is curious. Of the museum specimens included Figure 3. Results of Bayesian analysis showing the relationship among the 31 unique haplotypes of Pseudemys and the three outgroups. Numbers above each branch correspond to posterior probabilities greater than 0.90 for each recovered relationship. Parentheses contain haplotype codes (1–36), followed by sampling location, which correspond to those given in Table 1. 306 Southeastern Naturalist Vol. 11, No. 2 here, most accessions of P. peninsularis and both accessions of P. nelsoni were recovered in a single sub-clade of Clade 3 (Fig. 3). These two taxa share an overlapping geographic distribution, making these accessions the only lineage in our data set that appears to conform to any geographic pattern. In some respects, these results are consistent with previous findings (Spinks et al. 2009, Stephens and Wiens 2003, Wiens et al. 2010). However, our study is the first to include substantial species-level sampling of all recognized members of the genus. The patterns (or lack thereof) that we have recovered may reflect the potential pitfalls associated with using only mtDNA in this group (see recent review in Wiens et al. 2010). Alternatively, the lack of monophyly seen here may reflect a long history of mtDNA introgression and widespread hybrid swarms. Either way, taxonomic relationships within Pseudemys remain complex and elusive and continue to warrant further work. Potential pitfalls of mtDNA in Pseudemys Mitochondrial DNA sequence data has long been the tool of choice for molecular systematic and phylogeographic studies in animal taxa due to stability of genome order, relatively high mutation rate, uniparental inheritance, and ease of amplification (Avise 1994, 2000). In recent years, however, numerous studies have identified a growing number of exceptions to each of the reported advantages of mtDNA (see Galtier et al. 2009 for a recent review). As Galtier et al. (2009) acknowledged, even with these potential pitfalls, mtDNA continues to be the most practical first step to understanding molecular ecology of wild populations. The practical applications of mtDNA are the reason we chose these markers for addressing infrageneric relationships in Pseudemys, particularly given the lack of previously published molecular data on the group. Since the completion of the work presented here (Jackson 2009), Spinks et al. (2009) and Wiens et al. (2010) reported significant conflict between mtDNA and nucDNA in emydid turtles, suggesting that it would be inappropriate to depend on mtDNA alone. However, neither study included multiple accessions of all Pseudemys taxa. Spinks et al. (2009) actually commented on the fact that several taxa, including Graptemys, Pseudemys, and Trachemys, are taxonomically problematic and will need “extensive taxon and data sampling” to resolve relationships in these groups. Wiens et al. (2010) suggested that their own results reflected actual discrepancies between gene and species trees, but they were unable to invoke a specific mechanism to explain this. They were quick to exclude introgression as an option, but considering the limited sampling of Pseudemys taxa (single accessions of six taxa), the chances of any obvious signs of introgression being recovered in their molecular data set are limited. They also suggested that shorter-than-expected branch lengths in mtDNA of Graptemys and Pseudemys may be the result of numts, or mtDNA genes that have been transferred to the nuclear genome. However, they have no empirical data to support this hypothesis, and Spinks et al. (2009) found evidence for potential numts (polymorphisms within an individual mtDNA sequence) in only four accessions out of approximately 70 taxa across the Emydidae and related outgroups. While we cannot positively rule out the possibility of numts in Pseudemys without extensive additional effort, we found no polymorphic sequences within our accessions to suggest that this was an issue. 2012 T.G. Jackson, Jr., D.H. Nelson, and A.B. Morris 307 Evidence for introgression and hybrid swarms in Pseudemys? Given that the issues above do not explain the observed patterns in Pseudemys that are presented here, an alternative is needed. We suggest that historical and potentially recent introgression as the result of widespread hybrid swarms may be viable explanations. Wiens et al. (2010) argued that “recent, homogenizing introgression across the genus” is unlikely, stating that many taxa sampled in their study (P. gorzugi, P. nelsoni, P. rubriventris, and P. texana) are allopatric and geographically distant from each other. While recent introgression may not explain patterns in these particular species, mutations documented in mtDNA sequences may actually reflect historical introgression that occurred following glacial retreat in the Pleistocene, as has been hypothesized in many taxa across the southeastern US (see Avise 2000, Soltis et al. 2006 for recent reviews). As reviewed in Seidel and Ernst (1996), Pleistocene fossils of Pseudemys are categorized as one of three taxa: P. nelsoni (known from Florida, Georgia, Mississippi, and South Carolina), P. concinna (Georgia, Florida, South Carolina, Alabama, Indiana, Kansas, and possibly Oklahoma), and P. peninsularis (Florida). Additional reports of Pseudemys-like fossils from the Pleistocene of Texas are reported in Holman (1964). There are also reports of Pseudemys fossils from the Miocene and Pliocene of Florida (reviewed in Seidel and Ernst 1996). With the caveat that the fossil record is likely an incomplete representation of Pleistocene Pseudemys lineages, the existing records lead us to suggest that modern-day taxa may be relatively young, such that they are exhibiting patterns of incomplete lineage sorting of ancestral polymorphisms from their Pleistocene ancestors, which were partially sympatric. For example, given the disjunct geographic distributions of the three taxa included in the red-belly group (P. rubriventris, P. nelsoni, and P. alabamensis), it is possible to hypothesize that these three taxa may have arisen from a previously more widespread P. nelsoni as reflected in the fossil record. A similar pattern is seen in the modern-day Sternotherus oderatus (Latreille) (Common Musk Turtle; Kinosternidae), where three separate phylogeographic assemblages (one in the Carolinas, one in Florida, and one more interior/Mississippi River Valley) were recognized on the basis of mtDNA restriction site data (Walker et al. 1997). Lamb et al. (1994) suggested that members of the genus Graptemys (Emydidae), because of their reduced propensity for terrestrial dispersal, may have experienced increased rates of allopatric speciation caused by vicariant events that affected river habitats during the Pleistocene. Similar events may be responsible for present-day distributions of Red-bellies in the southeastern US. A detailed phylogeographic approach coupled with fossilbased divergence time estimation (similar to that used in Spinks and Shaffer 2009 in Emys) may further clarify these patterns in Pseudemys. Recent introgression may also play a role in some of the patterns observed here. Crenshaw (1965) found evidence of extensive hybridization between P. rubriventris and P. floridana in a lake in Richmond County, NC based on an electrophoretic survey of serum protein and morphological analyses. Unfortunately, much of Crenshaw’s discussion of putative hybrid zones in other regions (e.g., peninsular Florida) is difficult to follow due to major changes in turtle taxonomy since his publication in 1965. Arguments over the distinctiveness of P. c. concinna and P. c. floridana at different locations across their sympatric ranges also allude to the possibility of continuing or recent gene flow between these currently recognized 308 Southeastern Naturalist Vol. 11, No. 2 subspecific taxa (Jackson 1995, Seidel 1995). Microsatellite loci may prove more effective at teasing apart historical and recent hybridization events in this genus. Conservation implications As previously mentioned, three Pseudemys species are listed on the IUCN red list (2010) as either lower risk/near threatened (P. gorzugi and P. rubriventris) or endangered (P. alabamensis). Of these, only P. gorzugi was recovered as monophyletic in the present study, although limited sampling and missing data likely prevent us from being able to assess monophyly in P. rubriventris. We do not, however, recommend changes to the taxonomy of these organisms on the basis of the data presented here. The complex nature of the relationships within Pseudemys remain difficult to resolve, and revisionary taxonomists should be particularly cautious as a result. We sampled extensively across the range of P. alabamensis, collecting a total of 39 accessions from four locations in Alabama and one in Mississippi (Fig. 2, Table 1). We found no support for the recognition of Mississippi populations as a distinct evolutionary lineage, which was consistent with the findings of Lydeard (1996). Furthermore, we found limited variation across the accessions sampled, only recovering four distinct haplotypes within the species. This variation was far less than expected for the sampling effort given the number of haplotypes recovered within other sampled Pseudemys taxa (see Table 1). This result might be a reflection of the extremely limited geographic range of the species and could indicate a relatively small effective population size. Additional work is underway to better understand reproductive ecology in this federally endangered species (Hieb et al. 2011). Conclusions Phylogenetic relationships within Pseudemys are highly complex, likely as a result of retained ancestral polymorphism and possibly recent hybrid swarms. Such complexity warrants a battery of approaches, including multiple morphological and molecular markers. Future work to resolve questions of relatedness in this genus should focus their efforts on significant fine-scale sampling of sympatric and allopatric populations of all recognized taxa. Furthermore, consideration of molecular markers with different mutational rates (mtDNA/nucDNA sequences vs. microsatellites) coupled with fossil calibration points will be necessary to better comprehend underlying evolutionary processes from different points in time. Acknowledgments We thank K. Krysko for granting access to specimens from the FLMNH Osteological Collection, and G. Clark and A. Gomez (UF ICBR) for assistance with molecular work. We also thank M. Forstner and M. Gaston for contributing samples of P. gorzugi and P. texana from the M.R.J. Forstner Tissue Collection. Specimens of T. scripta and C. picta were provided by S. Graham and G. Sorrell. We would also like to thank J. Loo and P. Floyd for their contributions during trapping efforts. Finally, we thank B. Kreiser, G. Pauly, B. Thomson, P. Spinks, and several anonymous reviewers for their invaluable comments on previous versions of this manuscript. 2012 T.G. Jackson, Jr., D.H. Nelson, and A.B. Morris 309 Literature Cited Avise, J. 1994. Molecular Markers, Natural History, and Evolution. Chapman and Hall, New York, NY. 511 pp. Avise, J. 2000. Phylogeography: The History and Formation of Species. Harvard University Press, Cambridge, MA. 447 pp. Carr, A.F., Jr., and J.W. Crenshaw, Jr. 1957. A taxonomic reappraisal of the turtle Pseudemys alabamensis Baur. Bulletin of the Florida State Museum, Biological Science 2:25–42. Conant, R., and J.T. Collins. 1998. A Field Guide to Reptiles and Amphibians of Eastern and Central North America (3rd Edition). Houghton Mifflin Co., Boston, MA. 616 pp. Crenshaw, J.W. 1965. Serum protein variation in an interspecies hybrid swarm of turtles of the genus Pseudemys. Evolution 19:1–15. Dobie, J., and F. Bagley. 1990. Alabama Red-bellied Turtle (Pseudemys alabamensis) recovery plan. US Fish and Wildlife Service, Atlanta, GA. Ennen, J.R., J.E. Lovich, B.R. Kreiser, W. Selman, and C.P. Qualls. 2010. Genetic and morphological variation between populations of the Pascagoula Map Turtle (Graptemys gibbonsi) in the Pearl and Pascagoula Rivers with description of a new species. Chelonian Conservation and Biology 9:98–113. Ernst, C.H., and J.E. Lovich. 2009. Turtles of the United States and Canada, Second Edition. John Hopkins University Press, Baltimore, MD. 827 pp. Ernst, C.H., R.W. Barbour, and J.E. Lovich. 1994. Turtles of the United States and Canada. Smithsonian Institution Press, Washington, DC. Galtier N., B. Nabholz, S. Glémin, and G.D.D. Hurst. 2009. Mitochondrial DNA as a marker of molecular diversity: A reappraisal. Molecular Ecology 18:4541–4550. Hieb, E.E., T.G. Jackson, D.H. Nelson, and A.B. Morris. 2011. Characterization of eight polymorphic loci for the endangered Alabama Red-bellied Turtle (Pseudemys alabamensis; Emydidae). Conservation Genetics Resources 4:781–783. Huelsenbeck, J.P., and F. Ronquist. 2001. MRBAYES: Bayesian inference of phylogeny. Bioinformatics 17:754–755. International Union for the Conservation of Nature (IUCN). 2010. IUCN Red list of threatened species. Version 2010.4. Available online at http://www.iucnredlist.org. Accessed 19 May 2011. Jackson, D.R. 1995. Systematics of the Pseudemys concinna-floridana complex (Testudines: Emydidae): An alternative interpretation. Chelonian Conservation and Biology 1:329–333. Jackson, T.G. 2009. A phylogenetic appraisal of the endangered Alabama Red-bellied Turtle (Pseudemys alabamensis Baur). M.Sc. Thesis. University of South Alabama, Mobile, AL. 48 pp. Kemp, B.M., and D.G. Smith. 2005. Use of bleach to eliminate contaminating DNA from the surface of bones and teeth. Forensic Science International 154:53–61. Kozak, K.H., A. Larson, R.M. Bonett, and L.J. Harmon. 2005. Phylogenetic analysis of ecomorphological divergence, community structure, and diversification rates in dusky salamanders (Plethodontidae: Desmognathus). Evolution 59:2000–2016. Lamb, T.C., C. Lydeard, R. Walker, and J.W. Gibbons. 1994. Molecular systematics of map turtles (Graptemys): A comparison of mitochondrial restriction site versus sequence data. Systematic Biology 43:543–559. Leary, C.J., J.L. Dobie, T.M. Mann, and P.S. Floyd. 2003. Morphological variation in the endangered Alabama Red-bellied Cooter (Pseudemys alabamensis) and taxonomic status of a population in Mississippi. Chelonian Conservation and Biology 4:635–641. 310 Southeastern Naturalist Vol. 11, No. 2 Lenk, P., U. Joger, U. Fritz, P. Heidrich, and M. Wink. 1998. Phylogeographic patterns in the mitochondrial cytochrome-b gene of the European Pond Turtle, Emys orbicularis (Linnaeus, 1758). In U. Fritz, U. Joger, R. Podloucky, and J. Servan (Eds.). Proceedings of the EMYS symposium Dresden 96. Mertensiella 10:159–175. Lenk, P., and M. Wink. 1997. A RNA/RNA heteroduplex cleavage analysis to detect rare mutations in populations. Molecular Ecology 6:233–237. Lydeard, C. 1996. Genetic analysis of Pseudemys sp., the undescribed Mississippi Redbelly Turtle. Report to US Fish and Wildlife Service Endangered Species Office, Jackson, MS. Posada, D., and T.R. Buckley. 2004. Model selection and model averaging in phylogenetics: Advantages of Akaike information criterion and Bayesian approaches over likelihood ratio tests. Systematic Biology 53:793–808. Posada, D., and K.A. Crandall. 1998. Modeltest: Testing the model of DNA substitution. Bioinformatics 14:817–818. Ronquist, F., and J.P. Huelsenbeck. 2003. MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:1572–1574. Seidel, M.E. 1994. Morphometric analysis and taxonomy of the cooter and red-bellied turtles in the North American genus Pseudemys (Emydidae). Chelonian Conservation and Biology 1:117–130. Seidel, M.E. 1995. How many species of cooter turtles and where is the scientific evidence? A reply to Jackson. Chelonian Conservation and Biology 1:333–336. Seidel, M.E., and C.H. Ernst. 1996. Pseudemys. Catalogue of American amphibians and reptiles 625:1–7. Seidel, M.E., and W.M. Palmer. 1991. Morphological variation in turtles of the genus Pseudemys (Testidunes: Emydidae) from Central Atlantic drainages. Brimleyana 17:105–135. Soltis, D.S., A.B. Morris, J.S. McLachlan, P.S. Manos, and P.S. Soltis. 2006. Comparative phylogeography of unglaciated eastern North America. Molecular Ecology 15:4261–4293. Spinks, P.Q., and H.B. Shaffer. 2009. Conflicting mitochondrial and nuclear phylogenies for the widely disjunct Emys (Testudines: Emydidae) species complex, and what they tell us about biogeography and hybridization. Systematic Biology 58:1–20. Spinks, P.Q., R.C. Thomson, G.A. Lovely, and H.B. Shaffer. 2009. Assessing what is needed to resolve a molecular phylogeny: Simulations and empirical data from emydid turtles. BMC Evolutionary Biology 9:56. Starkey, D.E., H.B. Shaffer, R.L. Burke, M.R.J. Forstner, J.B. Iverson, F.J. Janzen, A.G.J. Rhodin, and G.R. Ultsch. 2003. Molecular systematics, phylogeography, and the effects of Pleistocene glaciation in the Painted Turtle (Chrysemys picta) complex. Evolution 57:119–128. Stephens, P.R., and J.J. Wiens. 2003. Ecological diversification and phylogeny of emydid turtles. Biological Journal of the Linnean Society 79:577–610. Walker, D., W.S. Nelson, K.A. Buhlmann, and J.C. Avise. 1997. Mitochondrial DNA phylogeography and subspecies issues in the monotypic freshwater turtle Sternotherus odoratus. Copeia 1:16–21. Wiens, J.J., C.A. Kuczynski, and P.R. Stephens. 2010. Discordant mitochondrial and nuclear gene phylogenies in emydid turtles: Implications for speciation and conservation. Biological Journal of the Linnean Society 99:445–461.