sena masthead
SENA Home Staff & Editors For Readers For Authors

Initial Observations of Kleptoplasty in the Foraminifera of Coastal South Carolina
Megan E. Cevasco, Shawnee M. Lechliter, Alexander E. Mosier, and Jasmine Perez

Southeastern Naturalist, Volume 14, Issue 2 (2015): 361–372

Full-text pdf (Accessible only to subscribers.To subscribe click here.)

 



Access Journal Content

Open access browsing of table of contents and abstract pages. Full text pdfs available for download for subscribers.

Issue-in-Progress: Vol. 25( 3) ... early view

Current Issue: Vol. 25 (2)
cover SENA 25(2)

Check out SENA's latest Monograph and current Special Issue in progress:

Monograph 13
SENA Monograph 13

Special Issue 13 in progress
SENA 24(special issue 13)

All Regular Issues

Monographs

Special Issues

 

submit

 

subscribe

 

JSTOR logoClarivate logoWeb of science logoBioOne logo EbscoHOST logoProQuest logo


Southeastern Naturalist 361 M.E. Cevasco, S.M. Lechliter, A.E. Mosier, and J. Perez 22001155 SOUTHEASTERN NATURALIST 1V4o(2l.) :1346,1 N–3o7. 22 Initial Observations of Kleptoplasty in the Foraminifera of Coastal South Carolina Megan E. Cevasco1,*, Shawnee M. Lechliter1, Alexander E. Mosier1, and Jasmine Perez1 Abstract - Kleptoplasty is a mixotrophic condition acquired by a heterotrophic grazer that ingests photosynthetic eukaryotic cells, wherein the plastids are not digested but rather are retained in the heterotrophic cell or organism in a photosynthetically active state. This phenomenon has been described in select foraminiferal taxa inhabiting nearshore and salt-marsh coastal habitats. We applied molecular and microscopic techniques to living foraminifera collected from South Carolina salt marshes (Waties Island and North Inlet) to determine if we could detect kleptoplasty. Sequence and confocal-imaging data recovered from 2 foraminiferal genera (Elphidium and Haynesina) indicated the functional retention of diatom plastids within these taxa. Introduction The term kleptoplasty is used to describe the ability of a heterotrophic organism to retain the photosynthetic organelles (plastids) of its prey (Rumpho et al. 2011). The sequestered plastids (kleptoplasts) remain functional within the herbivore for extended periods of time, enabling it to engage in phototrophy, thus converting a heterotroph into a mixotrophic chimera. Mixotrophy by kleptoplasty has been shown to have important stabilizing effects on the trophic structuring in ecosystems by increasing the total primary and secondary production in planktonic food webs, facilitating carbon transfer from microbial to metazoan trophic levels, and enhancing nutrient cycling (Hallock 2000, Handeler et al. 2009). Moreover, in addition to providing energy and carbon fixation, kleptoplasty may also contribute to providing oxygen in low-oxygen habitats (Bernhard and Bowser 1999). The retention of microalgal plastids has been identified in taxonomically disparate groups of invertebrates and marine protist hosts including dinoflagellates, ciliates, and foraminifera (Stoecker et al. 2009). Concomitant with host diversity, there is broad taxonomic diversity in the retained plastids ranging from haptophytes to chlorophytes, as well as a broad range in duration (days to months) of plastid retention within host taxa (Rumpho et al. 2011). This variability has led researchers to disparate characterizations of the kleptoplastic condition ranging from an ecological mechanism facilitating metabolic flexibility in the host taxa to an early evolutionary stage in permanent plastid acquisition (Gast et al. 2006, Stoecker et al. 2009). Foraminifera are protists characterized by a network of granuloreticulopods extending from openings in an external calcite or agglutinated test (Pawlowski et al. 1Department of Biology, Coastal Carolina University, Conway, SC 29528. *Corresponding author - mcevasco@coastal.edu. Manuscript Editor: Pamela Hallock Southeastern Naturalist M.E. Cevasco, S.M. Lechliter, A.E. Mosier, and J. Perez 2015 Vol. 14, No. 2 362 2013). Within the foraminifera, multiple genera are reported to harbor kleptoplasts: Bulimina, Elphidium, Haynesina, Nonion, Nonionella, Reophax, and Stainforthia (Pillet et al. 2011). The functional significance of these kleptoplasts to the foraminiferal host cell, however, remains unresolved. Feeding experiments conducted by Corriea and Lee (2002b) found that foraminifera preferentially retained diatom plastids and then emitted auto-fluorescence after 8 weeks incubation in a 12-h light/12-h dark cycle. The purpose of this work was to document foraminiferal kleptoplasty using confocal imaging as a tool to observe and characterize the condition in living specimens. Our research tested the hypothesis that kleptoplasty is an observable condition characteristic of select foraminiferal taxa resident in the salt marshes of coastal South Carolina. Using field collections paired with morphological observations, molecular identification, and confocal imaging, we explored the presence and character of the kleptoplastic condition in living foraminferal specimens. Methods Specimen collection We collected specimens for this study at Hog Inlet (33°50'38''N, 78°35'48''W) of Waties Island within Anne Tilghman Boyce Coastal Reserve, and from the North Inlet (33°19'28''N, 79.10'29.25''W) of Hobcaw Barony within Winyah Bay National Estuarine Research Reserve. Both the Waties Island and North Inlet collection sites are shallow, ocean-dominated, and subject to semi-diurnal tides resulting in fluctuating water depths, temperatures, and salinities. We collected specimens from both sites at low tide when the water level of the creeks was <1 m such that the top 1 cm of creek-bed sediments were easily removed by trowel. We took 10-cm3 sediment samples from the center of each creek bed and from the base of the Spartina alterniflora (Loiseleur-Deslongchamps) (Smooth Cordgrass)-dominated vegetation that lined the creek banks. We collected samples of the fine-grained sand and silty loam creek sediments in triplicate and transferred them into individual glass containers containing seawater for transport. Specimen preparation At the Coastal Carolina University, Conway, SC, we sieved samples and allowed the 125-μm to 500-μm fractions to settle for 12 h in filter-sterilized seawater at 23 °C. We used sterile-transfer pipets to remove 0.2-ml increments from the top layer of sediment slurry to a slide where, under magnification, we used sable brushes to search for viable foraminifera, which we identified by the presence of extended granuloreticulopodia in combination with distinctive pink to light brown cytoplasmic coloring. We transferred living specimens to petri dishes containing sterile seawater. Samples were subjected to additional cleaning with brushes and several transfers in sterile seawater, placed on a 45-μm membrane filter, and rinsed by vacuum filtration with 250 ml of sterile seawater. We selected potential kelptoplastic specimens that met general morphological criteria characteristic of either the genus Elphidium (de Montfort 1808) or the genus Haynesina (Banner and Culver 1978). We focused Southeastern Naturalist 363 M.E. Cevasco, S.M. Lechliter, A.E. Mosier, and J. Perez 2015 Vol. 14, No. 2 our collection efforts on these genera because they have been observed to engage in plastid retention in locations along the coast of the northeastern US (Correia and Lee 2002 a, b) and the northwestern coast of Europe (Cedhagen 1991, Lopez 1979, Pillet et al. 2011). Additionally, both genera had been previously reported as resident in the salt marshes and nearshore habitats of North Inlet (Collins et al. 1995). Although these potentially kelptoplastic genera are recognized by their planispiral involute chamber arrangement, rounded to sub-acute peripheral angle, and a moderately depressed umbilical area, species-level determinations are much more contentious due to distinguishing characteristics that are not easily observed externally, as well as to a high degree of phenotypic plasticity (Miller et al. 1982, Pillet et al. 2013, Schweizer et al. 2008); thus, we identified our specimens to genus. We kept potential kleptoplastic specimens in darkness for 5 days to allow for the complete digestion of any microalgae or cyanobacteria within their cytoplasm. We then divided remaining living specimens into subsets to be prepared for either molecular analysis or confocal microscopy. To eliminate any residual surface contaminants, we transferred both sets of specimens to 0.25-M EDTA solutions for 20 min to dissolve a majority of the calcite test encasing the foraminiferal cell via chelation prior to either confocal imaging or DNA extraction. Molecular techniques and analyses DNA extraction and PCR. We extracted DNA from single foraminiferal specimens including potential kleptoplastic genera Haynesina and Elphidium and the non-kleptoplastic genus Quinqueloculina using the DNeasy® Plant Mini Kit (Qiagen Inc., Valencia, CA). To efficiently extract nucleic acids, we used sterile blades under 40x magnification to break specimens apart, and a micro-mortar and pestle to pulverize the cellular contents within the DNeasy (Qiagen) lysis buffer. Following extraction, we performed total DNA quantification using the Qubit® 2.0 Fluorometer (Life Technologies, Grand Island, NY). Using an approach modified from Pillet et al. (2011), we performed PCR amplification on each specimen using 3 sets of primers: 18S foraminifera-ribosome specific, 16S plastid specific, and 18S diatom-ribosome specific (Table 1). We carried out the PCR reactions in a total volume of 25 μl using Ready-To-Go PCR Table 1. Primers used to amplify foraminiferal and kleptoplastic sequences. Target Primer name Oligonucleotide sequence Source Diatom ribosome DiatSSUF (for) 5'ACATCCAAGGAAGGCAGC A'3 Pillet et al. 2011 DiatSSUR (rev) 5'CTCTCAATCTGTCAATCCTCA'3 Pillet et al. 2011 Diatom plastid PLA491F (for) 5'GAGGAATAAGCATCGGCTAA'3 Fuller et al. 2006 OXY1313R (rev) 5'CTTCACGTAGGCGAGTTGCAGC'3 West et al. 2001 Foraminifera ribosome sA10 (for) 5'CTCAAAGATTAAGCCATGCAAGTGG'3 Schweizer et al. 2008 s17 (rev) 5'CGGTCACGTTCGTTGC'3 Schweizer et al. 2008 Southeastern Naturalist M.E. Cevasco, S.M. Lechliter, A.E. Mosier, and J. Perez 2015 Vol. 14, No. 2 364 beads (GE Biosciences, Pittsburgh, PA) with an amplification profile of 30 cycles of 30 s denaturation at 94 °C, 30 s of annealing at 50 °C, and 45 s of extension at 72 °C, followed by a final 5-min extension at 72 °C. We used amplification products from the foraminiferal-specific primers to determine the taxonomic identity and phylogenetic affinities of the specimens. We used the differential amplification patterns arising from algal-specific primers (plastid and ribosome) to indicate possible plastid retention within a given foraminiferal host. Specifically, we selected as likely kleptoplastic those specimens that generated amplification products from only the plastid primers and not the ribosomal primers. Conversely, we removed from further analyses the specimens generating PCR products from both sets of algal primers (plastid and ribosomal) because the presence of algal-cell material (other than plastid) within the host foraminifera obfuscated a determination of kleptoplasty. We cleaned all amplification products selected for molecular analysis using ExoSAP-IT ® (Affymetrics, Santa Clara, CA) and sent the samples to Selah Genomics (University of South Carolina, Greenville, SC) for sequencing. Phylogenetic analyses. We used the Geneious® 6.1.7 software package (Biomatters, Aukland, NZ) to edit sequence data. We conducted BLASTn searches (Altschul et al. 1990) to compare the sequences recovered in this study with those in the NCBI database and included in phylogenetic reconstructions those sequences from the NCBI database with high similarity to the query sequence. We employed MAFFTv7.017 (Katoh et al. 2005) implementing a progressive fast Fourier transform (FFT-NS-2) with a gap-opening penalty of 1.76 to perform alignments. Aligned sequences were then phylogenetically analyzed under the maximum likelihood optimality criterion implemented in PhyML 3.0 using a nearest neighbor interchange-topology search (Guindon and Gascuel 2003). Statistical selection of nucleotide-substitution models for phylogenetic likelihood analyses were determined using jModelTest by employing multiple selection approaches such as the likelihood ratio test and Akaike information criteria (Darriba et al. 2012). We selected as optimal for both the (746-nucleotide, 20-terminal) plastid-data set (-lnL = 2724.19) and the (2149-nucleotide, 19-terminal) foraminiferal-data set a simple Jukes-Cantor model (JC69) in which both base frequencies and substitution rates are equal-elected (Jukes and Cantor 1969). We determined branch support using 1000 bootstrap replicates implemented within the PhyML software. Microscopic techniques and analyses We used the confocal microscope (Zeiss 710) at the Hollings Cancer Center (Medical University of South Carolina, Charleston, SC) to image the prepared living foraminiferal cells. We produced composite images of the specimens using the plastid auto-fluorescence overlaid with differential interference contrast (DIC) microscopy and made optical sections of specimens at 1–2-μm intervals through the specimen to determine the size and position of kleptoplasts within the foraminiferal chambers. In addition, we performed spectral scans on a subset of plastids to determine the wavelength-emission profile of the auto-fluorescence and used Zeiss LSM image browser software (version 4.2) to analyze the confocal images. Southeastern Naturalist 365 M.E. Cevasco, S.M. Lechliter, A.E. Mosier, and J. Perez 2015 Vol. 14, No. 2 Specifically, we depth-coded images to determine the distribution of plastids within the specimens, and used electronic calipers to determine plastid dimensions. Results Molecular data We recovered 23 living potentially kleptoplastic foraminifera from the Waties Island collection (October 2012). This number represented a total number of specimens from 3 separate collection sites within the tidal creek. The collections from North Inlet (May 2013) were similarly sparse and patchy—24 specimens. The estimated population density of kleptoplastic specimens was 7.6 x 102/m2 for Waties Island and 6.3 x 102/m2 for North Inlet collections. Of the Waties Island foraminifera that we morphologically classified as potentially kleptoplastic, 15 belonged to the genus Elphidium and 8 to Haynesina. From North Inlet, 16 belonged to the genus Elphidium, while only 3 were identified as Haynesina. After specimen processing (cleaning and incubation), a total of 13 and 14 viable specimens remained from the Waties Island and North Inlet sites, respectively. Of these 27 foraminiferal specimens that we subjected to DNA extraction and PCR, 19 specimens positively amplified plastid sequences, though only 4 of those positive for plastid-sequence amplification were also negative for algal ribosomal-sequence am plification. Phylogenetic analysis of the foraminifera engaged in kleptoplasty confirmed that they belonged to the genera Elphidium and Haynesina (Fig. 1). When compared to other rotaliid foraminiferal sequences, the 3 kleptoplastic Elphidium specimens collected from Waties Island and 2 Elphidium specimens from North Inlet form a well bootstrap-supported (90) clade containing Elphidium exacavatum (Terquem) sequences. A North Inlet specimen morphologically identified as belonging to the genus Haynesina was placed within a clade, albeit with poor support values (59), with the taxon Haynesina germanica (Ehrenberg) and 2 Elphidium species. We used a non-kelptoplastic foraminiferal specimen (Quinqueloculina) collected at Waties Island as an outgroup sequence along with a Quinqueloculina seminulum L. ribosomal sequence from the NCBI database. Only 4 of the 6 plastid amplicons from the set of amplification products showing a kleptoplastic pattern generated sequence data sufficient for phylogenetic analysis with 17 additional diatom and bacterial sequences from the NCBI database (Fig. 2). Phylogenetic placement of these sequences indicates that they are diatom in origin. All 4 of the sequences (Waties Island Elphidium and Haynesina and North Inlet Elphidium amplifications) appear within a clade containing a marine raphid-diatom sequence from the genus Amphora (Ehrenberg ex Kützing). This clade has moderate (86) bootstrap support. Microscopic data Confocal imaging of the Waties Island and North Inlet foraminifera after a 5-d period of starvation in darkness identified autofluorescence originating from distinct structures within the foraminiferal cell (Fig. 3). We processed the reconstruction of z-stacked optical sections taken at 2-μm intervals into 3-dimensional Southeastern Naturalist M.E. Cevasco, S.M. Lechliter, A.E. Mosier, and J. Perez 2015 Vol. 14, No. 2 366 representations of specimen fluorescence to provide a means of assessing the number, position, and size of these active kleptoplastids within select depth strata of living foraminifera. Spectral analysis of the individual structures consistently showed emissions maxima at 672 nm, which corresponded to the spectral emissions profile of chlorophyll a, and supported a photosynthetic plastid origin for the fluorescence (Grabowski et al. 2001). Enumeration data compiled from 4 specimens identified an average of 9.6 ± 0.7 x 102 actively fluorescing plastids per foraminiferal host. Although the enumeration data presented here provide only a very coarse estimate of the number of plastids actively engaged in photosynthesis within a single foraminiferal host because it was drawn from a small sample size, the numbers correspond to previously reported estimates of plastid retention (Lopez 1979). Plastids appear to be distributed throughout the foraminiferal chambers as is shown in the 3-D reconstructions of optical sections imaged between 20 μm and 80 μm (Fig. 3A) and between 20 μm and 120 μm (Fig. 3D). Data collected for 64 plastids measured from 4 chambers within Elphidium and Haynesina specimens Figure 1. 18S rDNA phylogeny of foraminiferal specimens using a JC69 model as implemented in PhyML. Sequences from field collections are indicated in bold. NCBI accession numbers are given after the taxon name. Bootstrap values (>50) are indicated at the nodes. Southeastern Naturalist 367 M.E. Cevasco, S.M. Lechliter, A.E. Mosier, and J. Perez 2015 Vol. 14, No. 2 show a mean maximum length of 5.67 μm and width of 2.43 μm. We derived plastid dimensions from the diameter of autofluorescent areas measur ed as a proxy for plastid size (Fig. 3C, E; Table 2). We selected this method to exclude degraded plastids from measurement. The measurements recorded are consistent with plastid dimensions reported for raphid diatoms (Sato et al. 2013). We color-delineated depth coding in which the strength of autofluorescence detected at selected depth strata and used to determine the relative distribution of fluorescent signal within a foraminiferal host was applied to depths between 10 and 120 μm (Fig. 3F, G, H). Figure 2. 16S rDNA phylogeny of plastids retained within foraminiferal specimens using a JC69 model as implemented in PhyML. Sequences from field collections are indicated in bold. NCBI accession numbers are given after the taxon name. Bootstrap values (>50) are indicated at the nodes. Southeastern Naturalist M.E. Cevasco, S.M. Lechliter, A.E. Mosier, and J. Perez 2015 Vol. 14, No. 2 368 Figure 3. Confocal images of foraminiferal kleptoplasty. (A–C) Living Elphidium specimens imaged with confocal microscopy. (A) 3-D reconstruction of 2-μm optical sections imaged 20–80 μm below the cell surface. (B) DIC-image overlay to show position of plastids within specimen chambers. (C) Diameter of autofluorescent areas as a proxy for plastid size. (D) 3-D reconstruction of 2-μm optical sections of plastid autofluorescence imaged 20–120 μm below the cell surface in a living Haynesina foraminfer. (E) Diameter of autofluorescent areas within chambers as a proxy for plastid size. (F–H) Depth-coded image showing the concentration of fluorescent signal within a living Haynesina specimen. (F) Fluorescent signal 10–40 μm below surface of the specimen. (G) Fluorescent signal from a depth range of 40–80 μm below the cell surface. (H) Fluorescent signal representing depths of 10–120 μm. All scale bars are 100 μm unless otherwise indicated. Southeastern Naturalist 369 M.E. Cevasco, S.M. Lechliter, A.E. Mosier, and J. Perez 2015 Vol. 14, No. 2 Signal was detected throughout these sampled depth strata with the majority originating from depths 40–80 μm below the cell surface (Fig. 3G). Discussion We anticipated the identification of kleptoplasty in foraminifera (Elphidium and Haynesina) from both Waties Island and North Inlet based upon the broad distribution profiles of these genera and from reports of these taxa inhabiting similar habitats along the east coast of the US (Abbene et al. 2006, Culver and Horton 2005, Cushman 1936). Moreover, Collins et al. (1995) determined, based on the observation of test (shell) characteristics, that a significant portion (22%) of the total (non-living) foraminifera collected from a North Inlet marsh transect were members of the genus Elphidium. In comparison to total (live and dead) population estimates of kleptoplastic genera drawn from other locations (e.g., total Elphidium density of 105/m2 by Lopez [1979] from Limfjorden, Denmark), the densities of living kleptoplastic foraminifera from both collection sites were extremely low—7.6 x 102/m2 and 6.3 x 102/m2. Molecular phylogenetic analysis supported the classification of the specimens collected within the kleptoplastic genera Elphidium or Haynesina and revealed phylogenetically structured sequence variability. Because we only sequenced 6 kleptoplastic specimens and based our identifications on the strict criteria imposed in determining kleptoplasty, the taxonomic implications of the sequence variability require further exploration in future analyses. It is notable that in Figure 1 all but one of the foraminifera morphologically identified as Elphidium were found within a strongly bootstrap-supported (90) clade that also contained 2 E. excavatum sequences. The other Elphidium sequence belonged to a separate, poorly supported (54) clade containing 3 different Elphidium sequences. Moreover, the placement of the North Inlet Haynesina specimen within a poorly supported (59) clade containing both Elphidium (family Elphidiidae) and Haynesina (family Nonionidae) sequences is consistent with the complex paraphyletic relationships of these taxa recovered by Pillet et al. (2013). In addition to improving taxon sampling, the use of additional loci may help to resolve relationships among these taxa because both of these kleptoplastic genera demonstrate rapid evolution relative to other foraminifera (Schweizer et al. 2008). This characteristic is particularly relevant to members of the Elphidiidae in which recent analyses contingent upon outgroup designation recovered variable and complex paraphyletic relationships, including the placement of Haynesina within the Elphidiidae (Pillet et al. 2013). Table 2. Mean dimensions (μm) of plastids functionally retained within foraminiferal cells. Foraminifera 1 2 3 4 Specimen Length Width Length Width Length Width Length Width Chamber 1 4.75 3.00 5.25 2.75 4.50 3.00 5.50 2.00 Chamber 2 6.00 2.50 5.75 2.13 5.50 2.25 6.25 1.75 Chamber 3 5.13 3.25 6.50 3.25 6.25 1.75 5.75 1.50 Chamber 4 5.00 2.25 6.25 3.00 6.00 2.00 6.00 2.50 Southeastern Naturalist M.E. Cevasco, S.M. Lechliter, A.E. Mosier, and J. Perez 2015 Vol. 14, No. 2 370 The identity of retained plastid sequences as diatom in origin agrees with the analyses presented in Pillet et al. (2011). As shown in Figure 2, the placement of these sequences within a clade containing a broadly distributed benthic marine diatom, Amphora coffeaeformis (Agardh) Kützing, indicates that plastid acquisition is reflective of the hosts’ primary food source (diatoms). This result is also in agreement with the results of the feeding experiments of Correia and Lee (2000) that show Amphora coffeaeformis to be the preferred food choice of E. excavatum. Although the plastid sequences are moderately supported sister taxa, the low number of sequences recovered prevents us from drawing any robust conclusions about the diversity of kleptoplastid donors and indicates the need for further sampling. The loss of plastid sequences may indicate multiple diatom taxa contributing to the kleptoplastic condition within a single host cell, as was evident in the foraminiferal specimens investigated by Pillet et al. (2011). To overcome this issue, we are currently cloning PCR amplifications of plastid sequences into bacterial vectors prior to sequencing in our lab. Data generated from confocal imaging supported molecular phylogenetic inferences by providing evidence of functional diatom-derived plastids retained within live foraminiferal hosts. In agreement with TEM data presented in Cedhagen (1991), Correia and Lee (2002a), and Lopez (1979), confocal microscopy provided the structural detail of retained plastids and provides images of the kleptoplastic condition in live specimens. Correia and Lee (2002b) used autofluorescence data from a random sampling of individual optical sections as a means of determining plastid longevity after prolonged foraminiferal starvation. Using the 3-dimensional reconstructions from live foraminiferal specimens optically sectioned at a set intervals, confocal microscopy provides a means to create a functional snapshot, and provides data on the spectral profile, number, size, and position of kleptoplasts within the cell. Such data can be used in combination with ultrastructural TEM imaging and molecular sequence data to characterize foraminiferal kleptoplasty. For example, results from this study indicate that after 5 d of starvation, living heterotrophic foraminifers can actively emit chlorophyll a autofluorescence from >288 photosynthetic plastids. Despite the starvation period being 48 h longer, the numbers of plastids retained per specimen observed in this study are lower than those reported in Lopez (1979) for E. excavatum (1.2 ± 0.7 x 103), but may be reflective of confocal imaging detecting only non-degraded plastids. This observation is worth further investigation because it may indicate a period of stability after the kleptoplastic condition is established rather than an immediate onset of plastid degeneration. The emissions spectra, size, and distribution patterns of plastids observed in the Waties Island and North Inlet specimens are consistent with previously reported phylogenetic and ultrastructural data implicating diatom origins for plastids retained in Elphidium and Haynesina specimens. When considered together, the confocal data support a scenario in which the kleptoplastic condition within living foraminifera is established when the plastids of diatoms being phagocytosed are Southeastern Naturalist 371 M.E. Cevasco, S.M. Lechliter, A.E. Mosier, and J. Perez 2015 Vol. 14, No. 2 vacuolated and transferred throughout the cell. Characterization of kleptoplasty in foraminfera as a phenomenon of ecological convenience, a kind of opportunistic photosynthetic farming, or alternatively, as a stage in ongoing symbiotic evolutionary processes, remains an open question (Bernhard and Bowser 1999, Stoecker et al. 2009). Using comparative data from multiple methodological approaches is critical to understanding the many unknown parameters of this enigmatic phenomenon as it relates to the complexity of microbial processes in salt-marsh habitats. Acknowledgments This project was supported by an NSF EAGER DEB grant (0935333), the Belle Baruch Foundation Grant 35-2969, and the CCU PEG-grant (17-4802). Literature Cited Abbene, I., S. Culver, D. Corbett, M. Buzas, and L. Tully, 2006. Distribution of foraminifera in Pamlico Sound, North Carolina, over the past century. Journal of Foraminiferal Research 36(2):135–151. Altschul, S.F., W. Gish, W. Miller, E.W. Myers, and D.J. Lipman. 1990. Basic local alignment- search tool. Journal of Molecular Biology 215:403–410. Banner, F.T., and S.J. Culver. 1978. Quaternary Haynesina n. gen. and Paleogene Protelphidium Haynes: Their morphology, affinities, and distribution. The Journal of Foraminiferal Research 8(3):177–207. Bernhard, J., and S. Bowser, 1999. Benthic foraminifera of dysoxic sediments: Chloroplast sequestration and functional morphology. Earth-Science Reviews 46:149–165. Cedhagen, T. 1991. Retention of chloroplasts and bathymetric distribution in the sublittoral foraminiferan Nonionellina labradorica. Ophelia 33(1):17–30. Collins, E., D. Scott, P. Gayes, and F. Medioli. 1995. Foraminifera in Winyah Bay and North Inlet marshes, South Carolina: Relationship to local pollution sources. Journal of Foraminiferal Research 25(3):212–223. Correia, M.J., and J.J. Lee. 2000. Chloroplast retention by Elphidium excavatum (Terquem). Is it a selective process? Symbiosis 29:343–355. Correia, M.J., and J.J. Lee. 2002a. Fine structure of the plastids retained by the foraminifer Elphidium excavatum (Terquem). Symbiosis 32:15–26. Correia, M.J., and J.J. Lee. 2002b. How long do the plastids retained by the foraminifer Elphidium excavatum (Terquem) last in their host? Symbiosis 32:27–38. Culver, S., and B. Horton. 2005. Infaunal marsh foraminifera from the Outer Banks, North Carolina, USA. Journal of Foraminiferal Research 35(2):148–170. Cushman, J.A. 1936. Some new species of Elphidium and related genera. Contributions from the Cushman Laboratory for Foraminiferal Research 12:78–89. Darriba D., G.L. Taboada, R. Doallo, and D. Posada. 2012. jModelTest 2: More models, new heuristics, and parallel computing. Nature Methods 9(8):772. de Montfort, P.D. 1808. Conchyliologie Systématique et Classification Méthodique de Coquilles, 1. F. de Schoell, Paris, France. 409 pp. Fuller, N.J., G.A. Tarran, D.G. Cummings, E.M.S.Woodward, K. M.Orcutt, M. Yallo, F. Le Gall, and D.J. Scanlan. 2006. Molecular analysis of photosynthetic picoeukaryotecommunity structure along an Arabian Sea transect. Limnology and Oceanography 51:2502–2514. Southeastern Naturalist M.E. Cevasco, S.M. Lechliter, A.E. Mosier, and J. Perez 2015 Vol. 14, No. 2 372 Gast, R.J., D.M. Moran, M.R., Dennett, and D.A. Caron. 2006. Kleptoplasty in an Anarctic dinoflagellate: Caught in evolutionary transition? Environmental Biology 9(1):38–45. Grabowski, B., F.X. Cunningham, and E. Gantt. 2001. Chlorophyll and carotenoid- binding in a simple red algal light-harvesting complex crosses phylogenetic lines. Proceedings of the National Academy of Science 98(5):2911–2916. Guindon, G., and P. Gascuel. 2003. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Systematic Biology 52:696–704. Hallock, P. 2000. Symbiont-bearing foraminifera: Harbingers of global change. Micropaleontology 46(Suppl. 1):95–104. Handeler, K., Y. Grzymbowski, P. Krug, and H. Wagele. 2009. Functional chloroplasts in metazoan cells: A unique evolutionary strategy in animal life. Frontiers in Zoology 6:28. Jukes T.H., and C.R. Cantor. 1969. Pp. 21–132, In H.N. Munro (Ed.). Evolution of Protein Molecules. Academic Press, New York, NY. Katoh, K., K. Kuma, H. Toh, and T. Miyata. 2005. MAFFT version 5: Improvement in accuracy of multiple-sequence alignment. Nucleic Acids Research 33:511–518. Lopez, E. 1979. Algal chloroplasts in the protoplasm of three species of foraminifera: Taxonomic affinity, viability, and persistence. Marine Biology 53:201–211. Miller, A.A.L., D.B. Scott, and F.S., Medioli. 1982. Elphidium excavatum (Terquem): Ecophenotypic versus subspecific variation. Journal of Foraminiferal Research 12(2):116–144. Pawlowski, J., M. Holzmann, and J. Tyszka. 2013. New supraordinal classification of Foraminifera: Molecules meet morphology. Marine Micropaleontology 100:1–310. Pillet, L., C. de Vargas, and J. Pawlowski. 2011. Molecular identification of sequestered diatom chloroplasts and kleptoplastidy in foraminifera. Protist 162:394–404. Pillet, L., I. Voltski., S. Korsun., and J. Pawlowski. 2013. Molecular phylogeny of Elphidiidae (foraminifera). Marine Micropaleontology 103:1–14. Rumpho, M., K. Pelletreau, A. Moustafa, and D. Bhattacharya. 2011. The making of a photosynthetic animal. The Journal of Experimental Biology 214:303–311. Sato, S., N. Tamotsu, and D.G. Mann. 2013. Morphology and life history of Amphora commutata (Bacillariophyta) I: The vegetative cell and phylogenetic position. Phycologia 52(3):225–238. Schweizer, M., J. Pawlowski, T.J. Kouwenhoven, J. Guiard, and B. Vanderzwaan. 2008. Molecular phylogeny of Rotaliida (foraminifera) based on complete small subunit rDNA sequences. Marine Micropaleontology 66:(3–4):233–246. Stoecker, D., M. Johnson, C. De Vargas, and F. Not. 2009. Acquired phototrophy in aquatic protists. Aquatic Microbial Ecology 57:279–310. Terquem, O. 1875. Essai sur le classement des animaux qui vivent sur la plage et dans les environs de Dunkerque, pt 1. Mémoires de la Société Dunkerquoise por l’Encouragement des Sciences des Lettres et des Arts (1874–1875) 19:405–457. West N.J., W.A. Schoenhuber, N.J. Fuller, R.I. Amann, R. Rippka, A.F. Post, and D.J. Scanlan. 2001. Closely related Prochlorococcus genotypes show remarkably different depth distributions in two oceanic regions as revealed by in situ hybridization using 16SrRNAtargeted oligonucleotides. Microbiology 147:1731–1744.